ORFeome > tubb4b ORF1 – XORFeome v1.0

tubb4b ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: tubb4b
Gene ID: 969453
Gene Page ID: 969446
ORF Xenbase ID: 17302929

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054297
Original XGC clone length: 1338

Human orthology & disease relationships

NCBI Entrez ID: 10383
Ensembl gene IDs: ENSG00000188229
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 103050,180105,219500,268000,400042,608688,610015

Library Location

Plate ID: GDExl11002
Well Location: C12

Sequences - 5ʹ (forward) EST

Accession: JZ839403
dbEST ID: 79657105
Trimmed Sequence: ATGAGGGAAATCGTGCACTTGCAGGCTGGACAGTGCGGCAATCAGATTGGTGCCAAGTTCTGGGAAGTGATCAGCGATGAGCATGGAATTGACCCAACTGGTGCCTACCATGGGGACAGTGACCTGCAGCTGGAGAGAATCAATGTGTATTACAATGAAGCAACAGGTGGCAAGTACGTTCCCCGCGCTGTGCTGGTTGATCTTGAACCTGGGACCATGGACTCTGTGCGCTCAGGGCCATTTGGGCAGATATTCAGGCCTGACAACTTTGTATTTGGTCAAAGTGGTGCTGGAAACAACTGGGCCAAGGGCCACTACACAGAGGGAGCAGAACTGGTTGACTCCGTGTTGGATGTTGTAAGGAAAGAAGCAGAAAGCTGTGACTGTCTCCAGGGCTTCCAGCTGACTCACTCTCTGGGGGGTGGCACTGGCTCTGGCATGGGTACACTGCTCATCAGCAAAATCAGGGAAGAGTACCCAGACAGAATCATGAACACATTCAGTGTAGTGCCCTCCCCTAAAGTGTCTGACACAGTAGTAGAGCCATACAACGCCACCCTGTCAGTGCACCAGCTTGTAGAGAACACTGATGAGACCTACGGTATAGATAATGAAGCCCCTGTATGATATCTGCCTCAAAACCCTAAAACCCACCACAGCCACCTATGGGGAACCTGAACCCTTTGGTTCTAACCCCAAAGAATTGGGGGTAACTACCCGGGCGGCCAATTCCCTGGCCCCCCTCATTGCGTGACCTGCGCCAAAACTGGGCTTTT
Full Trace Sequence: TCGGGGGCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAGGGAAATCGTGCACTTGCAGGCTGGACAGTGCGGCAATCAGATTGGTGCCAAGTTCTGGGAAGTGATCAGCGATGAGCATGGAATTGACCCAACTGGTGCCTACCATGGGGACAGTGACCTGCAGCTGGAGAGAATCAATGTGTATTACAATGAAGCAACAGGTGGCAAGTACGTTCCCCGCGCTGTGCTGGTTGATCTTGAACCTGGGACCATGGACTCTGTGCGCTCAGGGCCATTTGGGCAGATATTCAGGCCTGACAACTTTGTATTTGGTCAAAGTGGTGCTGGAAACAACTGGGCCAAGGGCCACTACACAGAGGGAGCAGAACTGGTTGACTCCGTGTTGGATGTTGTAAGGAAAGAAGCAGAAAGCTGTGACTGTCTCCAGGGCTTCCAGCTGACTCACTCTCTGGGGGGTGGCACTGGCTCTGGCATGGGTACACTGCTCATCAGCAAAATCAGGGAAGAGTACCCAGACAGAATCATGAACACATTCAGTGTAGTGCCCTCCCCTAAAGTGTCTGACACAGTAGTAGAGCCATACAACGCCACCCTGTCAGTGCACCAGCTTGTAGAGAACACTGATGAGACCTACGGTATAGATAATGAAGCCCCTGTATGATATCTGCCTCAAAACCCTAAAACCCACCACAGCCACCTATGGGGAACCTGAACCCTTTGGTTCTAACCCCAAAGAATTGGGGGTAACTACCCGGGCGGCCAATTCCCTGGCCCCCCTCATTGCGTGACCTGCGCCAAAACTGGGCTTTT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGGGAAATCGTGCACTT

Sequences - 3ʹ (reverse) EST

Accession: JZ839402
dbEST ID: 79657104
Trimmed Sequence: GGCATTTTCCTCCTCTTCCCCTTCCTCAAACTCTCCCTCCTCCTCAGCCGTGGCATCCTGGTACTGTTGGTACTCAGACACCAGGTCGTTCATGTTGCTCTCGGCCTCAGTGAATTCCATCTCATCCATGCCCTCACCTGTGTACCAGTGCAAGAAGGCCTTTCTGCGGAACATGGCGGTGAACTGCTCAGAGATGCGCTTGAACAGCTCCTGGATGGCTGTGCTGTTGCCGATGAAGGTGGCAGACATTTTCAGGCCTCTGGGTGGGATGTCGCAGACTGCGGTCTTAACGTTGTTGGGGATCCATTCCACAAAGTAGCTGCTGTTCTTGTTCTGCACATTCAGCATCTGCTCATCCACTTCTTTCATGGACATGCGGCCCCTGAAAATGGCAGCTACAGTCAGATAGCGGCCATGACGGGGGTCACAGGCAGCCATCATGTTCTTGGCATCGAACATCTGTTGGGTGAGTTCTGGCACGGTTAAGGCACGGTACTGCTGGCTACCCCTGCTGGTGAGTGGAGCAAAGCCAGGCATGAAGAAGTGCAGACGGGGGGAATGGGACCATATTGACAGCCAGTTTGCGCAGGTCAGCATTGAGCTGGCCAGGGAAACCCAGGCAAGTAGTTACCCCCACTCATGTGGCTGAGACCAAGTGGTTCAAGTTCCCATAAAGGGGGGTGTGGGTAGATTTTAGGGTT
Full Trace Sequence: GGAGCAAACAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGGCATTTTCCTCCTCTTCCCCTTCCTCAAACTCTCCCTCCTCCTCAGCCGTGGCATCCTGGTACTGTTGGTACTCAGACACCAGGTCGTTCATGTTGCTCTCGGCCTCAGTGAATTCCATCTCATCCATGCCCTCACCTGTGTACCAGTGCAAGAAGGCCTTTCTGCGGAACATGGCGGTGAACTGCTCAGAGATGCGCTTGAACAGCTCCTGGATGGCTGTGCTGTTGCCGATGAAGGTGGCAGACATTTTCAGGCCTCTGGGTGGGATGTCGCAGACTGCGGTCTTAACGTTGTTGGGGATCCATTCCACAAAGTAGCTGCTGTTCTTGTTCTGCACATTCAGCATCTGCTCATCCACTTCTTTCATGGACATGCGGCCCCTGAAAATGGCAGCTACAGTCAGATAGCGGCCATGACGGGGGTCACAGGCAGCCATCATGTTCTTGGCATCGAACATCTGTTGGGTGAGTTCTGGCACGGTTAAGGCACGGTACTGCTGGCTACCCCTGCTGGTGAGTGGAGCAAAGCCAGGCATGAAGAAGTGCAGACGGGGGGAATGGGACCATATTGACAGCCAGTTTGCGCAGGTCAGCATTGAGCTGGCCAGGGAAACCCAGGCAAGTAGTTACCCCCACTCATGTGGCTGAGACCAAGTGGTTCAAGTTCCCATAAAGGGGGGTGTGGGTAGATTTTAGGGTT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGCATTTTCCTCCTCTTCCCCT