ORFeome > tubg1 ORF1 – XORFeome v1.0

tubg1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: tubg1
Gene ID: 866048
Gene Page ID: 491265
ORF Xenbase ID: 17302953

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC097771
Original XGC clone length: 1356

Human orthology & disease relationships

NCBI Entrez ID: 7283
Ensembl gene IDs: ENSG00000131462
Directly associated (OMIM) disease MIM numbers: 615412
Indirectly associated (Lage, et al.) disease MIM numbers: 115200,215600,253300,253400,253550,600334,603689,604145,608807,608808

Library Location

Plate ID: GDExl11089
Well Location: F12

Sequences - 5ʹ (forward) EST

Accession: JZ838379
dbEST ID: 79656081
Trimmed Sequence: ATGCCACGGGAGATTATCACCCTGCAACTTGGCCAGTGTGGAAATCAGATTGGATTTGAGTTCTGGAAGCAGCTATGGTGCAGAACATGGCATCAGCCCTGAAGGTATTGTGGAAGAGTTCGCGACTGAAGGTACCGACAGGAAAGATGTATTTTTTTATCAGGCTGATGATGAGCATTACATTCCAAGAGCTGTTCTTCTGGACTTAGAACCGAGGGTTATCCACTCTATACTTAATTCTCCATATGCCAACCTGTACAACCCTGAGAACATTTACCTGTCTGAACATGGAGGTGGTGCTGGAAACAACTGGGCTAGTGGTTTCTCACAGGGTGAAAAAATTCATGAAGATATCTTTGACATTATTGACCGAGAAGCTGATGGCAGTGATAGTCTGGAGGGATTCGTGCTTTGCCATTCAATAGCAGGTGGAACAGGCTCTGGTTTAGGATCTTACCTTTTGGAGAGATTAAATGACAGGTATCCCAAGAAGTTGGTCCAGACATACTCGGTTTTCCCAAACCAAGATGAAATGAAGTGATGTTGTGGTACAGCCTTACAACTCCCTTCTAACACTTAAGAGACTTACACAGAATGCAGACTGGTGTGGTGGTTGTAGATAACACAACTCCTAATCAAATT
Full Trace Sequence: GGCCCCATATAATTGGATTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCCACGGGAGATTATCACCCTGCAACTTGGCCAGTGTGGAAATCAGATTGGATTTGAGTTCTGGAAGCAGCTATGGTGCAGAACATGGCATCAGCCCTGAAGGTATTGTGGAAGAGTTCGCGACTGAAGGTACCGACAGGAAAGATGTATTTTTTTATCAGGCTGATGATGAGCATTACATTCCAAGAGCTGTTCTTCTGGACTTAGAACCGAGGGTTATCCACTCTATACTTAATTCTCCATATGCCAACCTGTACAACCCTGAGAACATTTACCTGTCTGAACATGGAGGTGGTGCTGGAAACAACTGGGCTAGTGGTTTCTCACAGGGTGAAAAAATTCATGAAGATATCTTTGACATTATTGACCGAGAAGCTGATGGCAGTGATAGTCTGGAGGGATTCGTGCTTTGCCATTCAATAGCAGGTGGAACAGGCTCTGGTTTAGGATCTTACCTTTTGGAGAGATTAAATGACAGGTATCCCAAGAAGTTGGTCCAGACATACTCGGTTTTCCCAAACCAAGATGAAATGAAGTGATGTTGTGGTACAGCCTTACAACTCCCTTCTAACACTTAAGAGACTTACACAGAATGCAGACTGGTGTGGTGGTTGTAGATAACACAACTCCTAATCAAATT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCCACGGGAGATTATCAC

Sequences - 3ʹ (reverse) EST

Accession: JZ838378
dbEST ID: 79656080
Trimmed Sequence: TTTATCCTGGGTTCCCCAAGAAATGTAGTCTGGACGAGTAGCTGCATGGTATTCATCTATTAACTGCTGTACAATTTCTCTTGAATTATCCAGCTCATCAAAGTTGTCCTTAAAGATGTCCTCCTTGCGGAACTGCTCCAAGAAAGCTTCACGTTTTCGCAGTTTGTCATACTGACGGCAGGTCCTTTCAAACAGCGAGGAGATATTGGTGTGATTGGCCATCATTAGGCCGCTGACCCGGTGTGCAGATGGCAAATAAGGTGACTTTCTTGACAAAGCAACTTGGATGCTGGCAGGTCCCCATGGGATAAAGTTTGCCAGCTTCCTCTCTCGAATCCTCTGAAGGCTTTTGTGCACCTGTGTAGGATCCACCTCCCCTTGAATGATATTGAGTATTGCAATATAGCAGTGGTTGGTTTGCCTGTCACGGCCAGTGGATACCATAACATTTTTAGGCTGCAGTAGCCTTCTCATGACATCCAACACTGTAGTCTTACGCACACTGGCCACCGACTGATCAGTAGTCAGCGGTGTGTATCCTGTCATCAGGAAGTGTAGACGAGGGGTTGGGATAAGAGAGGCAATGAGACCAATCAAGTCATTGTTCATGTATCCTGGGTACCTAAAGTT
Full Trace Sequence: GGGCATACTGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGNCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTTATCCTGGGTTCCCCAAGAAATGTAGTCTGGACGAGTAGCTGCATGGTATTCATCTATTAACTGCTGTACAATTTCTCTTGAATTATCCAGCTCATCAAAGTTGTCCTTAAAGATGTCCTCCTTGCGGAACTGCTCCAAGAAAGCTTCACGTTTTCGCAGTTTGTCATACTGACGGCAGGTCCTTTCAAACAGCGAGGAGATATTGGTGTGATTGGCCATCATTAGGCCGCTGACCCGGTGTGCAGATGGCAAATAAGGTGACTTTCTTGACAAAGCAACTTGGATGCTGGCAGGTCCCCATGGGATAAAGTTTGCCAGCTTCCTCTCTCGAATCCTCTGAAGGCTTTTGTGCACCTGTGTAGGATCCACCTCCCCTTGAATGATATTGAGTATTGCAATATAGCAGTGGTTGGTTTGCCTGTCACGGCCAGTGGATACCATAACATTTTTAGGCTGCAGTAGCCTTCTCATGACATCCAACACTGTAGTCTTACGCACACTGGCCACCGACTGATCAGTAGTCAGCGGTGTGTATCCTGTCATCAGGAAGTGTAGACGAGGGGTTGGGATAAGAGAGGCAATGAGACCAATCAAGTCATTGTTCATGTATCCTGGGTACCTAAAGTT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTTATCCTGGGTTCCCCAA