ORFeome > twist1 ORF2 – XORFeome v1.0

twist1 ORF2 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: twist1
Gene ID: 865309
Gene Page ID: 479801
ORF Xenbase ID: 17303013

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123238
Original XGC clone length: 501

Human orthology & disease relationships

NCBI Entrez ID: 7291
Ensembl gene IDs: ENSG00000122691
Directly associated (OMIM) disease MIM numbers: 101400,123100,180750
Indirectly associated (Lage, et al.) disease MIM numbers: 101400,180750

Library Location

Plate ID: GDExl11088
Well Location: E07

Sequences - 5ʹ (forward) EST

Accession: JZ838267
dbEST ID: 79655969
Trimmed Sequence: ATGATGCAGGAAGAGTCCAGCTCGCCAGTCTCCCCAGTAGACAGTCTGAGTAACAGCGAGGAAGAGCTTGACAAGCAGCAGAGCAAGAGGGGATGCAGAAAGAGGCGATCTGCTAGGAAAAGCCCCGAGGATCCCGACAGTCCGATCTCAGTGAAGCGCAACAAGAAGGCGAGCAGCACCGGCAGTAGCCCCCAGTCCTTTGAGGAGCTGCAGAGTCAGAGGGTCATGGCCAATGTCAGGGAGCGTCAGAGGACTCAGTCCCTCAACGAAGCCTTCTCGTCCTTGAGAAAGATCATCCCCACCCTCCCCTCGGACAAACTGAGTAAAATCCAAACGCTCAAACTGGCCTCCAGATACATCGACTTTCTCTGCCAGGTCTTACAGAGCGACGAGCTGGACTCCAAAATGGCCAGCTGCAGTTATGTGGCCCATGAGAGGCTCAGCTATGCCTTCTCCGTGTGGAGGATGGAGGGAGCCTGGTCCATGTCTGCATCTCACTT
Full Trace Sequence: TCGGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGATGCAGGAAGAGTCCAGCTCGCCAGTCTCCCCAGTAGACAGTCTGAGTAACAGCGAGGAAGAGCTTGACAAGCAGCAGAGCAAGAGGGGATGCAGAAAGAGGCGATCTGCTAGGAAAAGCCCCGAGGATCCCGACAGTCCGATCTCAGTGAAGCGCAACAAGAAGGCGAGCAGCACCGGCAGTAGCCCCCAGTCCTTTGAGGAGCTGCAGAGTCAGAGGGTCATGGCCAATGTCAGGGAGCGTCAGAGGACTCAGTCCCTCAACGAAGCCTTCTCGTCCTTGAGAAAGATCATCCCCACCCTCCCCTCGGACAAACTGAGTAAAATCCAAACGCTCAAACTGGCCTCCAGATACATCGACTTTCTCTGCCAGGTCTTACAGAGCGACGAGCTGGACTCCAAAATGGCCAGCTGCAGTTATGTGGCCCATGAGAGGCTCAGCTATGCCTTCTCCGTGTGGAGGATGGAGGGAGCCTGGTCCATGTCTGCATCTCACTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTAAAATAAAACAAAAGAAAAAGTCACAATCTGTCTGATTTTACAAGGGGGGGAGGGGGGGGAAACTTCCCCCCCCCCGGGGGGGGGGGGGCGCCCTCGGTGAATGTGTGGGTGGGGGAGGCCCGGGCGGGTAACCAGGGTTGTCATGGAAAAAGAGAAAAAAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGATGCAGGAAGAGTCCAG

Sequences - 3ʹ (reverse) EST

Accession: JZ838266
dbEST ID: 79655968
Trimmed Sequence: GTGAGATGCAGACATGGACCAGGCTCCCTCCATCCTCCACACGGAGAAGGCATAGCTGAGCCTCTCATGGGCCACATAACTGCAGCTGGCCATTTTGGAGTCCAGCTCGTCGCTCTGTAAGACCTGGCAGAGAAAGTCGATGTATCTGGAGGCCAGTTTGAGCGTTTGGATTTTACTCAGTTTGTCCGAGGGGAGGGTGGGGATGATCTTTCTCANNGACGAGAANGCTTCNTTGAGGGACTGAGTCCTCTGACGCTCCCTGACATTGGCCATGACCCTCTGACTCTGCAGCTCCTCAAAGGACGGGCGGCTACAGCCTGTGCTGCTCGCCTTCTTGTTGCGCTTCACTGAGATCAGACTGTCGGGATCCTCGTGGGTGTTACATACAAATCGCAACTTTCTGCATCGCCGTCTGGCGGGGGGGTTGGCGAGGTCTTCCTCTCTTTTATTGCAAATGTCTAGTGAGGAGGCTGAGAAGGAGACTCTTGCTCCTTCACGGTGCGACGTTTTTGTTTAAAGTTAGCTTAAGAATAAACGTAGGTGGGTCAACTCTTTGCACAAACAAGGTCGTGTGGGGTGAAGTGGGAGGGGNANGTAAAAAAAAAAAGAAAAAAAAAAAATTCGTGTTCTCTCGACAACAGATGAGGAGGGGGGGAAAAAAATGACTCTCCCCGGGGGCGGGGGGGGGCCCTTGTGTTAAGGATTTTGGGGGGGGGGGAACCCCCGGNAGGGNGGCAACAACCACAAAAAAAAAAAGAAAA
Full Trace Sequence: GGGAAACGGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTGAGATGCAGACATGGACCAGGCTCCCTCCATCCTCCACACGGAGAAGGCATAGCTGAGCCTCTCATGGGCCACATAACTGCAGCTGGCCATTTTGGAGTCCAGCTCGTCGCTCTGTAAGACCTGGCAGAGAAAGTCGATGTATCTGGAGGCCAGTTTGAGCGTTTGGATTTTACTCAGTTTGTCCGAGGGGAGGGTGGGGATGATCTTTCTCANNGACGAGAANGCTTCNTTGAGGGACTGAGTCCTCTGACGCTCCCTGACATTGGCCATGACCCTCTGACTCTGCAGCTCCTCAAAGGACGGGCGGCTACAGCCTGTGCTGCTCGCCTTCTTGTTGCGCTTCACTGAGATCAGACTGTCGGGATCCTCGTGGGTGTTACATACAAATCGCAACTTTCTGCATCGCCGTCTGGCGGGGGGGTTGGCGAGGTCTTCCTCTCTTTTATTGCAAATGTCTAGTGAGGAGGCTGAGAAGGAGACTCTTGCTCCTTCACGGTGCGACGTTTTTGTTTAAAGTTAGCTTAAGAATAAACGTAGGTGGGTCAACTCTTTGCACAAACAAGGTCGTGTGGGGTGAAGTGGGAGGGGNANGTAAAAAAAAAAAGAAAAAAAAAAAATTCGTGTTCTCTCGACAACAGATGAGGAGGGGGGGAAAAAAATGACTCTCCCCGGGGGCGGGGGGGGGCCCTTGTGTTAAGGATTTTGGGGGGGGGGGAACCCCCGGNAGGGNGGCAACAACCACAAAAAAAAAAAGAAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTGAGATGCAGACATGGA