ORFeome > twistnb ORF1 – XORFeome v1.0

twistnb ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: twistnb
Gene ID: 5812715
Gene Page ID: 5812676
ORF Xenbase ID: 17303019

ORF full-length analysis tests

Full-Length confidence: low
Original XGC clone accession: BC122515
Original XGC clone length: 951

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11088
Well Location: F04

Sequences - 5ʹ (forward) EST

Accession: JZ838073
dbEST ID: 79655775
Trimmed Sequence: ATGCCCATTGAAAATTGGCTGCGTATTGGTGTTAAAATAGACGACGAGATAGAGTTTGAAGTATTCCGTTTAGATTCAGATGCCATTGGTGTATTTTGTATACGTGGACGACTAGATGAGAGCATGGAGGCCAAAGCTTATGAAACCTCATGTGAAGAGACGGCTGAGCAGACTGATGGTGGAACATCTGATAAAGATGCAGATGCCCTTGAGAACTCAAATATGGAATCCAGCATCCAAACAAATGGTGATGTCCAGGACAAATCAAAGAAAAAACACAAGAAACAGAAATTGCGAGAGTCGCTTACACAGGAAGCTGAGAGCACAGGTGATAATTCTATAGTTGCAGATCCAGATCTAGAAAATCCTGTAGAATTAAATGTAGAAACTCCGAAAAAAGAGCGCAAGAAAAAGAAACATAAGAATGTTCTTGGGCAGAATAGTGAATCTGATGCTGAGAAAGGTTTAGACAGCACAAGCTTTGAAGAAAGCATTAATACAGAATCGCCAGTTATTTTAACTGAGACCAGACCAAAAAAATCCAAGAACAAGGGTAAGGAGATTCTTCATTCTAATGATACTGCCACTGGGTTTCTCAATGCAGTAGGGTGAAATGAAAATAATTCCGAAGTTCCAGCTCGTGAACCGAAAAAAAAAAAAAGAAGGTGGAAGGGGGCGGAGGGAGGTTAAGGGGAAAACACAGACCCCCGCGCCGGGGACA
Full Trace Sequence: TCCGGGGCCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCCCATTGAAAATTGGCTGCGTATTGGTGTTAAAATAGACGACGAGATAGAGTTTGAAGTATTCCGTTTAGATTCAGATGCCATTGGTGTATTTTGTATACGTGGACGACTAGATGAGAGCATGGAGGCCAAAGCTTATGAAACCTCATGTGAAGAGACGGCTGAGCAGACTGATGGTGGAACATCTGATAAAGATGCAGATGCCCTTGAGAACTCAAATATGGAATCCAGCATCCAAACAAATGGTGATGTCCAGGACAAATCAAAGAAAAAACACAAGAAACAGAAATTGCGAGAGTCGCTTACACAGGAAGCTGAGAGCACAGGTGATAATTCTATAGTTGCAGATCCAGATCTAGAAAATCCTGTAGAATTAAATGTAGAAACTCCGAAAAAAGAGCGCAAGAAAAAGAAACATAAGAATGTTCTTGGGCAGAATAGTGAATCTGATGCTGAGAAAGGTTTAGACAGCACAAGCTTTGAAGAAAGCATTAATACAGAATCGCCAGTTATTTTAACTGAGACCAGACCAAAAAAATCCAAGAACAAGGGTAAGGAGATTCTTCATTCTAATGATACTGCCACTGGGTTTCTCAATGCAGTAGGGTGAAATGAAAATAATTCCGAAGTTCCAGCTCGTGAACCGAAAAAAAAAAAAAGAAGGTGGAAGGGGGCGGAGGGAGGTTAAGGGGAAAACACAGACCCCCGCGCCGGGGACA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCCCATTGAAAATTGGCTGCGT

Sequences - 3ʹ (reverse) EST

Accession: JZ838072
dbEST ID: 79655774
Trimmed Sequence: TTTTTTATGTTTCTTTTTGATCTTGGGTTCTAAAGCCAAAATGTCTTGATCATCTTCTTCATGCTGTCTTTTTGCTGTTTTGTGCTTGCTTTGGGAACTCCCAGGCAGTAAATGTTCTTGATGTTTTGACTTATGCTTTTTTGCCTTCGGTGTTTCCTGAGATACAGCGAGACCTTCGGTGAGAGATTCTTCAGATGAGACACAACTGACAAGGTTACTGTTGGGGTTCTGTTCCACGTTAGAGCGCTTGTGTTTTTTCTTAAACTTGTCTGGGACACCTCCACTTGCTGTCATTTCTTCTGGTTCAAGAGCAGGACTTTCGGAAAAACTTTCATTTTCAACTACTCCATTGAGAAAACCAGAGGCAGTATCATTAGAATGAAGAATCTCCTTACCCTTCTTCTTGGATTTTTTTGGTTTGGTCTCAGTTAAAATAACTGGCGATTCTGTATTAATGCTTTCTTCAAAGCTTGTGCTGTCTAAACCTTTCTCACCATCACATTCACTATTCTGCCCAACAACATTCTTATGTTTCTTTTTCTTGCGCCCTTTTTTCAGAGTTTCTACAAATAATTCAACAGGATTTTCGAGATCTGGAACCGCAACTATAAAAATATCAACGGGTGCCCTCAACGTTCCTGGGAAAAGCAAATCGCGCAAATTTCTTTTTCTTGGTGTTTTTTTCTTTGAATTTTGTCCTTGGGACAAACCCAAAATTAGTTTTGA
Full Trace Sequence: GGGGAAACGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTTTTTATGTTTCTTTTTGATCTTGGGTTCTAAAGCCAAAATGTCTTGATCATCTTCTTCATGCTGTCTTTTTGCTGTTTTGTGCTTGCTTTGGGAACTCCCAGGCAGTAAATGTTCTTGATGTTTTGACTTATGCTTTTTTGCCTTCGGTGTTTCCTGAGATACAGCGAGACCTTCGGTGAGAGATTCTTCAGATGAGACACAACTGACAAGGTTACTGTTGGGGTTCTGTTCCACGTTAGAGCGCTTGTGTTTTTTCTTAAACTTGTCTGGGACACCTCCACTTGCTGTCATTTCTTCTGGTTCAAGAGCAGGACTTTCGGAAAAACTTTCATTTTCAACTACTCCATTGAGAAAACCAGAGGCAGTATCATTAGAATGAAGAATCTCCTTACCCTTCTTCTTGGATTTTTTTGGTTTGGTCTCAGTTAAAATAACTGGCGATTCTGTATTAATGCTTTCTTCAAAGCTTGTGCTGTCTAAACCTTTCTCACCATCACATTCACTATTCTGCCCAACAACATTCTTATGTTTCTTTTTCTTGCGCCCTTTTTTCAGAGTTTCTACAAATAATTCAACAGGATTTTCGAGATCTGGAACCGCAACTATAAAAATATCAACGGGTGCCCTCAACGTTCCTGGGAAAAGCAAATCGCGCAAATTTCTTTTTCTTGGTGTTTTTTTCTTTGAATTTTGTCCTTGGGACAAACCCAAAATTAGTTTTGA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTTTTTATGTTTCTTTT