ORFeome > txlna ORF1 – XORFeome v1.0

txlna ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: txlna
Gene ID: 992930
Gene Page ID: 992925
ORF Xenbase ID: 17303043

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123340
Original XGC clone length: 1542

Human orthology & disease relationships

NCBI Entrez ID: 200081
Ensembl gene IDs: ENSG00000084652
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 122700,188050,188055,202400,277450,607473

Library Location

Plate ID: GDExl11084
Well Location: B01

Sequences - 5ʹ (forward) EST

Accession: JZ837352
dbEST ID: 79655054
Trimmed Sequence: ATGAAGGACCAAGAACTGGAGACTGTCACAGCCAAAGGGCCTACTTCATCCAGCCCCTCGCTTCCTCCATCTGCACATGAGAACTTGACTTCATCTGAAGTTTGTCATCCAGAAGTGGAAGCAGAAGGAGCAGCTGGTAATGCTATTACTGTATGTGATGTATCTGAAGAGCTAAGTAGGCAACTGGAAGATATCCTTAATACGTATTGTGTTGATGACAAGCAAGAGGGAGCAGGAGACTCAGAGGAGACAGAAAAGGGAGCACAGGAGACACCAAAGAATGGTGATACTGAACTAGTAGTCCAAGAGGTTAATGGTGAGAAGGAGGAAAATAAAGTTTTAGAAGACAGTAGAACCATCAATGAAACCGAAAAAGACCAGAAAAGAATGCAAGATAAGAAAAAAGTAAAGGGTCTTGGGAAGGAGATCACCTTATTAATGCAGACTCTGAACACTCTCAGCACGCCAGAGGAAAAACTGACTGCCCTGTGTAAGAAGTATGCAGAACTGTTGGAGGAGCACAGGACATCTCAGAAGCAAATGAGGATACTACAGAAAAAACAAACGCAGCTTATCCAAGAGAAGGACCAACTTCGTAATGAGCATAGCAAGGCCATCCTGGCAAGAAGCAAACTGGAAAGTTTGTGCAGAGAGCTACAGAGAACACACCGTACCCTAAAGGAGGAAGGAGTACAGAGGCTCGTTGAGGAGGAAAAAAACGCAAGGGAATTACCCCCTCATTTCCAAGTGACCCTCCATGAAATTCCAATTCCCAAAATGGAACCAACCACAAAGGAAAGGAAAAAAGGCAAAAC
Full Trace Sequence: CGCGGGCCCAATAATGGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAAGGACCAAGAACTGGAGACTGTCACAGCCAAAGGGCCTACTTCATCCAGCCCCTCGCTTCCTCCATCTGCACATGAGAACTTGACTTCATCTGAAGTTTGTCATCCAGAAGTGGAAGCAGAAGGAGCAGCTGGTAATGCTATTACTGTATGTGATGTATCTGAAGAGCTAAGTAGGCAACTGGAAGATATCCTTAATACGTATTGTGTTGATGACAAGCAAGAGGGAGCAGGAGACTCAGAGGAGACAGAAAAGGGAGCACAGGAGACACCAAAGAATGGTGATACTGAACTAGTAGTCCAAGAGGTTAATGGTGAGAAGGAGGAAAATAAAGTTTTAGAAGACAGTAGAACCATCAATGAAACCGAAAAAGACCAGAAAAGAATGCAAGATAAGAAAAAAGTAAAGGGTCTTGGGAAGGAGATCACCTTATTAATGCAGACTCTGAACACTCTCAGCACGCCAGAGGAAAAACTGACTGCCCTGTGTAAGAAGTATGCAGAACTGTTGGAGGAGCACAGGACATCTCAGAAGCAAATGAGGATACTACAGAAAAAACAAACGCAGCTTATCCAAGAGAAGGACCAACTTCGTAATGAGCATAGCAAGGCCATCCTGGCAAGAAGCAAACTGGAAAGTTTGTGCAGAGAGCTACAGAGAACACACCGTACCCTAAAGGAGGAAGGAGTACAGAGGCTCGTTGAGGAGGAAAAAAACGCAAGGGAATTACCCCCTCATTTCCAAGTGACCCTCCATGAAATTCCAATTCCCAAAATGGAACCAACCACAAAGGAAAGGAAAAAAGGCAAAAC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAAGGACCAAGAACTGGA

Sequences - 3ʹ (reverse) EST

Accession: JZ837351
dbEST ID: 79655053
Trimmed Sequence: TTCAGCTGCAGTGTTGGGAAGAACTGGGAATGAAGGTGCATTTTGCTGCCCACAGGTTCCATCGTCACTTAGTCCTGCATTTTCTGCAAGTGGAAGGCCTGTACAGCTGCTGGATTCCTCTTGTGTGACAAGTTGGCCTGGAGGGGCCTCTAAGGATTTACACAGGTTCTGAACCTTCTTGTTCAAGTCATTCCGTTCTGTCTGTAAAGCCCGACAAAGCTTCTCAAGTTTCTGGATCTTGGCTTGCAAAGCCTCTTGCTCTTTGTCTCGCAGGGTTTTCTCTTCTGCCATGACAAGCAATGCTTTATTACTGCTCTCCCATCGGGACCTATACATGGTTGTCTCTTTTTCCAGCTTCTTGATCTTCTTTGTCATCTTTTCCATTTCTTGTTTAAAAGTGGTGAAAACCTCATTGCTTTTGGACAAAGTGTTTTGAAATTCCTCAAACTTCTCTGTATACAGTGCTAGCTGCTGCTTGAGGTGGGTCTCTTGCTGTTTCATAAGTTCACACATGCGCTGTGATTCCACTGCCTCTTTCAAGAGAAATTCTTTTTCCCGCTGGTGACGCTCTTCCACCTCTTTCAGCATTTCTTGTGCTTGCTGAAGCTTGGCGTCCACTAGCTGTTGTTGAAAATCCTTATGTTTTAAAACTTTGGTCGATGTGCTCTTTCCCTAGCTTCTATTTCCTCAATAAGCCTTCTTTAAATTCAAATTAACAAATTTCAAACCTTTTCCCTTGAACAAAAATTTAAGAA
Full Trace Sequence: GAAGACGGCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTCAGCTGCAGTGTTGGGAAGAACTGGGAATGAAGGTGCATTTTGCTGCCCACAGGTTCCATCGTCACTTAGTCCTGCATTTTCTGCAAGTGGAAGGCCTGTACAGCTGCTGGATTCCTCTTGTGTGACAAGTTGGCCTGGAGGGGCCTCTAAGGATTTACACAGGTTCTGAACCTTCTTGTTCAAGTCATTCCGTTCTGTCTGTAAAGCCCGACAAAGCTTCTCAAGTTTCTGGATCTTGGCTTGCAAAGCCTCTTGCTCTTTGTCTCGCAGGGTTTTCTCTTCTGCCATGACAAGCAATGCTTTATTACTGCTCTCCCATCGGGACCTATACATGGTTGTCTCTTTTTCCAGCTTCTTGATCTTCTTTGTCATCTTTTCCATTTCTTGTTTAAAAGTGGTGAAAACCTCATTGCTTTTGGACAAAGTGTTTTGAAATTCCTCAAACTTCTCTGTATACAGTGCTAGCTGCTGCTTGAGGTGGGTCTCTTGCTGTTTCATAAGTTCACACATGCGCTGTGATTCCACTGCCTCTTTCAAGAGAAATTCTTTTTCCCGCTGGTGACGCTCTTCCACCTCTTTCAGCATTTCTTGTGCTTGCTGAAGCTTGGCGTCCACTAGCTGTTGTTGAAAATCCTTATGTTTTAAAACTTTGGTCGATGTGCTCTTTCCCTAGCTTCTATTTCCTCAATAAGCCTTCTTTAAATTCAAATTAACAAATTTCAAACCTTTTCCCTTGAACAAAAATTTAAGAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTCAGCTGCAGTGTTGGG