ORFeome > txn ORF1 – XORFeome v1.0

txn ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: txn
Gene ID: 5895453
Gene Page ID: 5895391
ORF Xenbase ID: 17303049

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC084818
Original XGC clone length: 318

Human orthology & disease relationships

NCBI Entrez ID: 7295
Ensembl gene IDs: ENSG00000136810
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 103050,180849,223100,245590,300068,307030,500003,551500,603903

Library Location

Plate ID: GDExl11006
Well Location: D04

Sequences - 5ʹ (forward) EST

Accession: JZ840050
dbEST ID: 79657752
Trimmed Sequence: ATGGTGAGGTACCTGAACAGCCTGGAGGAATACCACTGTGCACTGAAAGATGCCGGTGAGAAACTTGTGGTGATTGACTTTACTGCAGTAGGGTGTGGCCCGTGCCAAAGAATTGCCCCAGACTTTGAAAAGCTCAGCACCGAGAATCCTGATATTGTATTGTTCAAAGTAGATGTAGATAATGCATCGGATGTGGCTCAACTCTGTGGAGTTCGCTCCATGCCAACATTCGTTTTCTACAAGTCTGGCAAAGAGGTTGAGCGGTTCAGTGGTGCTGATATATCGAAACTGAAGAGTACGATCAGCAGGTTATGCTT
Full Trace Sequence: GGGGCTCTAGCTCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGTGAGGTACCTGAACAGCCTGGAGGAATACCACTGTGCACTGAAAGATGCCGGTGAGAAACTTGTGGTGATTGACTTTACTGCAGTAGGGTGTGGCCCGTGCCAAAGAATTGCCCCAGACTTTGAAAAGCTCAGCACCGAGAATCCTGATATTGTATTGTTCAAAGTAGATGTAGATAATGCATCGGATGTGGCTCAACTCTGTGGAGTTCGCTCCATGCCAACATTCGTTTTCTACAAGTCTGGCAAAGAGGTTGAGCGGTTCAGTGGTGCTGATATATCGAAACTGAAGAGTACGATCAGCAGGTTATGCTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAACTCTAAAAAAAAAACAAAAATCAAAAATATTATATTTCCCTCTTCCCGCCCCCCAAAAAAAAAAAAAATTCCCGGAATACCGCGGTTCTGGTTTGTGTTTTTTTTGAAAAAAAGAAGGGAAAAAACACCCAAAAAAAAGGGGTTGCTTTTGGGGGGTGAATGGAAGCCCGCGGGGGCGCCCCCCACCCGGGTCCAAACCCTATCCCCACCGGGGGGGGGGGGGGGGGGCGGGGGGGGTTTTTTGGTGTGTTTTTTTTTTTTTTTTTTGTTTATTTCTTCCTCCCCCATCACCCTCCCCAACCAAAAAAACACCCACCCACCCAGGGCGCAGGCG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGTGAGGTACCTGAAC

Sequences - 3ʹ (reverse) EST

Accession: JZ840049
dbEST ID: 79657751
Trimmed Sequence: GCATAACCTGCTGATCGTACTCTTCAGTTTCGATATATCAGCACCACTGAACCGCTCAACCTCTTTGCCAGACTTGTAGAAAACGAATGTTGGCATGGAGCGAACTCCACAGAGTTGAGCCACATCCGATGCATTATCTACATCTACTTTGAACAATACAATATCAGGATTCTCGGTGCTGAGCTTTTCAAAGTCTGGGGCAATTCTTTGGCACGGGCCACACCATACTGCAGTAAAGTCAATCACCACAAGTTTCTCACCGGCATCTTTCAGTGCACAGTGGTATTCCTCCAGGCTGTTCAGGTACCTCACCATGG
Full Trace Sequence: AAAACTGCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGCATAACCTGCTGATCGTACTCTTCAGTTTCGATATATCAGCACCACTGAACCGCTCAACCTCTTTGCCAGACTTGTAGAAAACGAATGTTGGCATGGAGCGAACTCCACAGAGTTGAGCCACATCCGATGCATTATCTACATCTACTTTGAACAATACAATATCAGGATTCTCGGTGCTGAGCTTTTCAAAGTCTGGGGCAATTCTTTGGCACGGGCCACACCATACTGCAGTAAAGTCAATCACCACAAGTTTCTCACCGGCATCTTTCAGTGCACAGTGGTATTCCTCCAGGCTGTTCAGGTACCTCACCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGCCCGAGCTTAAAACAGTCAGACAGATACAATTAAGAGAATGGCGGGAACTGCGGGCCCGGACAAAATGAAAGGACAACGAGATACCTGCGCTGCGGGGTGTTGATGCTGGGGAAGGGAATGAAGGCGGAACACCAAAGAACCAAGGTAGCTGGGTTGGTAAGTGGTAAGGCAGGTTTTGGTAGGGGTGCTGCACCTGGCCGAAAACCCTGACCAAACGGCGGGGGGGGAAGGGGCCGGGGGGGGGTTGGTGGGTGTGTGAAGGATTTGTTTTTTTGGGGTGGCTTCTCAAGCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCATAACCTGCTGATCGTACT