ORFeome > txndc15 ORF1 – XORFeome v1.0

txndc15 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: txndc15
Gene ID: 987700
Gene Page ID: 987695
ORF Xenbase ID: 17303061

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123146
Original XGC clone length: 1029

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11086
Well Location: A11

Sequences - 5ʹ (forward) EST

Accession: #N/A
dbEST ID: #N/A
Trimmed Sequence: #N/A
Full Trace Sequence: GCTCGGGGCCCAATAATGATTTTATTTTGACTGATAGTGNACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCGGGTGAATGTGCAGCGGTATAATTCTAAACACCTTGAGGCCACATTTCTGCAGGCCATGGACCCTCATTTCTATACTCTGCCAATAACGATACCTAAATTACATTTATTGGCACTATATGCTTCACAACACATCAACCTTTCAACTCCATTTGGCACAATATCACTTCCAAACATCCTGCTGTTTCAAGGGGCCAAACCTATGGCGAGATTTAATCACACTGATCGGAAGATGGAAGCGCTAAAATCTTTTATATTTAATCAATCAAGTATAGAAACAGAGACCGAGGTGATAGTTACTGAACATGACTGTGATAAACCATTACCCTGTGATCCAAAAGTACAAAATGATTGGCTTCATGGATTCTATGTGAAATATATAATCATTTTCATCATACCTAACACAATACAGACTCAAATTATACACTGGTTTATAACAAGGCAAGAAAATTAACAAAAAGATGTTTCTATATTTATGTACAATATTAAATTATTAGCAAACAATTGCTCATCAATTTGATGCAACACAGCGGTCACTCTCAGTAATAGAAAAAACTCTTATTTTTCGTACAATTAAAAAAAAAAAAAAAAAAAAATAAAAAAAAAAGATAACGATAAAAAAAAAAACCACAAGAAAAAAAATTTACTTTCCCAGAAAACAAAATTTAACTTGATTACATCCGGCTGCNGAAGAGGTGACCTAAAAAAAAAAAAAAAAATAAAAAAAAAAAAAAATATAATATAATNCTCTATATATAAATAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAATAAATAAAAAAAAATTTAAACGATAAAAAAAGAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCGGGTGAATGTGCAGCGGT

Sequences - 3ʹ (reverse) EST

Accession: #N/A
dbEST ID: #N/A
Trimmed Sequence: #N/A
Full Trace Sequence: AAAACTGCTTATGACCATGTAATACGACTCACTACTAGGGGAGATCAGCCTGGAGGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTCTTGATGCTCATGCTCTTGCCCGGGCAGAATCCCGCGCATAATTTCCGCCGGCATAGTGGCCTATACCATGAACATGGTTACATAAATCACATAGAATACTAGCAATCCAATCTCTTCCTACAGTTGGAGCACAGGGTAATGGACTCTCACAGTCATCTTCAATACCTACCACCCCCTGCGCTGCTTCAATAACTGACTAATTAAATATAAAAGACTTGAACGCATCCAGCTTCCGATCAAAGAAATTAAATCTCGCCATATGTTTGGCCCCTTAGAAACAGCAAGATGTTAGGAACAGCTACTGTGCCAACTCAACTTGAAAGGCTGCAAAATAGTAAAGCATCTAGTGCCAAGAAATGTAACGTCACAACCGCTCTTGGCAGAGTATTAGAATAAAGAGGCCCGCCTGCANAAAAACGGCACCACGGGGTGTAGAACAATACCCGTGCGCATTCACCCCCATGGTGGCAAGGTTTATTTAGAAAAAGGCNTTGGTNAAAAAACATACTCGTGCAGAAAGATAAAAGAAAAANGTACGAACANNCNNNNNNNNAAAAAAAATAGNNAGNCGGGCAAGAAAACAAAAAGCAAAANGNAAAAAACAAAAANGGGAAAAAGNGNNNNNAAAAAAAAAAANANNNNNNAANNNNNNGGGNGAAAAAAAAAAAAGGAGNNNGNNNNNNNNNNNGNNAAAAAAAAAAAAAACAAAAAAAAGAAAAAAAAAAAAGAAGGGGNGNNGNAAGAGAAAAAAAAAAAAAAAAAGAAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTCTTGATGCTCATGCTCTTGCC