ORFeome > txndc9 ORF1 – XORFeome v1.0

txndc9 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: txndc9
Gene ID: 990785
Gene Page ID: 990777
ORF Xenbase ID: 17303079

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054292
Original XGC clone length: 681

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11002
Well Location: C03

Sequences - 5ʹ (forward) EST

Accession: JZ839339
dbEST ID: 79657041
Trimmed Sequence: ATGGCAGCTGACACGTCTGTGGATATGTATGCAAAAGTCATGGAGAATCAGCTTCTTCAGACAGCCAAAATAATGGAAGAGCAGTTAGATGCTGAACTAGAGAAACTCGACAAAACAGATGAAGATGAAATGGAGCTTCTAAAAGAAAGAAGACTTGAAGCCTTGAAGAAGGTACAGAAACAAAAACAAGAATGGCTATCTAAAGGACATGGGGAATATCGAGAGATACCCAGTGAAAGAGAATTCTTCCAGGAAGTGAAAGAGAGTAAAAATGTTGTCTGCCATTTCTACAAAGATTCCACCTTCAGATGTAAAATTCTGGACAAACATTTGCCAATGCTTGCGAAAAAGCACGTCGAGACCAAGTTTCTAAAGCTGAATGTGGAGAAAGCGCCCTTCCTGTGTGAAAGACTGCACATAAAAGTCATTCCTACACTGGCACTGGTAAAAGATGGCAAGACTAAAGATTACATTGTTGGCTTCACAGATCTGGGAAACACTGATGAATTTACCACAGAGACATTAGAGTGGAGACTTGGTTGTGCTGGTATTATAAACTACAGTGGGAATCTAATGGAGCCACCGTTTCAAAACCAGAAGAAATATGGCACACATTTTACAAAGCTGGAAAAGAAAACTATAAGAGGAAAAAAGTATGATTCAAATTCTGATGATGATTT
Full Trace Sequence: CGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCAGCTGACACGTCTGTGGATATGTATGCAAAAGTCATGGAGAATCAGCTTCTTCAGACAGCCAAAATAATGGAAGAGCAGTTAGATGCTGAACTAGAGAAACTCGACAAAACAGATGAAGATGAAATGGAGCTTCTAAAAGAAAGAAGACTTGAAGCCTTGAAGAAGGTACAGAAACAAAAACAAGAATGGCTATCTAAAGGACATGGGGAATATCGAGAGATACCCAGTGAAAGAGAATTCTTCCAGGAAGTGAAAGAGAGTAAAAATGTTGTCTGCCATTTCTACAAAGATTCCACCTTCAGATGTAAAATTCTGGACAAACATTTGCCAATGCTTGCGAAAAAGCACGTCGAGACCAAGTTTCTAAAGCTGAATGTGGAGAAAGCGCCCTTCCTGTGTGAAAGACTGCACATAAAAGTCATTCCTACACTGGCACTGGTAAAAGATGGCAAGACTAAAGATTACATTGTTGGCTTCACAGATCTGGGAAACACTGATGAATTTACCACAGAGACATTAGAGTGGAGACTTGGTTGTGCTGGTATTATAAACTACAGTGGGAATCTAATGGAGCCACCGTTTCAAAACCAGAAGAAATATGGCACACATTTTACAAAGCTGGAAAAGAAAACTATAAGAGGAAAAAAGTATGATTCAAATTCTGATGATGATTTGCCAACTTTCTTGTACAAAAGTTGGCCATATAAGAAAACATTTGCTTATCAATTTGTTTGCACCGAAACAGGTCACTTATCATTCAAAATAAAAATCATTTATTTTGCCCATTCCAGCCTTGAAATTCCCCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCAGCTGACACGTCTGTGG

Sequences - 3ʹ (reverse) EST

Accession: JZ839338
dbEST ID: 79657040
Trimmed Sequence: ATCATCATCAGAATCTGAATCATACTTTTTTCCTCTTATAGTTTTCTTTTCCAGCTTTGTAAAATGTGTGCCATATTTCTTCTGGTTTTGAAACGGTGGCTCCATTAGATTCCCACTGTAGTTTATAATACCAGCACAACCAAGTCTCCACTCTAATGTCTCTGTGGTAAATTCATCAGTGTTTCCCAGATCTGTGAAGCCAACAATGTAATCTTTAGTCTTGCCATCTTTTACCAGTGCCAGTGTAGGAATGACTTTTATGTGCAGTCTTTCACACAGGAAGGGCGCTTTCTCCACATTCAGCTTTACAAACTTGGTCTCGACGTGCTTTTTCGCAAGCATTGGCAAATGTTTGTCCAGAATTTTACATCTGAAGGTGGAATCTTTGTATAAATGGCAGACAACATTTTTACTCTCTTTCACTTCCTGGAAGAATTCTCTTTCACTGGGTATCTCTCGATATTCCCCATGTCCTTTAGATAGCCATTCTTGTTTTTGTTTCCGTACCTTTCTTCAGGCTTCAAGTCTTCTTTCTTTTAAAAGCTCCATTTTCTCTTCATCTTGTTTGTCCAGTTTCCCTAGGTTCACATCTAAAGTGCTCTTCCATTAATTTGGTTGGCTGAAAAAACTGATTCTCCAAGGACTTTTGCTAACAAATCCCCAAAACGGGGTCAGCGTGCCCAGGGGGGCAAACTTTTTTTGGTAAAAAATTTGGGCAAAAAAAAAAAAAACTTTTGCCTCATCCATTTTTTTTTGGAAAACAAAA
Full Trace Sequence: GCAAGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAATCATCATCAGAATCTGAATCATACTTTTTTCCTCTTATAGTTTTCTTTTCCAGCTTTGTAAAATGTGTGCCATATTTCTTCTGGTTTTGAAACGGTGGCTCCATTAGATTCCCACTGTAGTTTATAATACCAGCACAACCAAGTCTCCACTCTAATGTCTCTGTGGTAAATTCATCAGTGTTTCCCAGATCTGTGAAGCCAACAATGTAATCTTTAGTCTTGCCATCTTTTACCAGTGCCAGTGTAGGAATGACTTTTATGTGCAGTCTTTCACACAGGAAGGGCGCTTTCTCCACATTCAGCTTTACAAACTTGGTCTCGACGTGCTTTTTCGCAAGCATTGGCAAATGTTTGTCCAGAATTTTACATCTGAAGGTGGAATCTTTGTATAAATGGCAGACAACATTTTTACTCTCTTTCACTTCCTGGAAGAATTCTCTTTCACTGGGTATCTCTCGATATTCCCCATGTCCTTTAGATAGCCATTCTTGTTTTTGTTTCCGTACCTTTCTTCAGGCTTCAAGTCTTCTTTCTTTTAAAAGCTCCATTTTCTCTTCATCTTGTTTGTCCAGTTTCCCTAGGTTCACATCTAAAGTGCTCTTCCATTAATTTGGTTGGCTGAAAAAACTGATTCTCCAAGGACTTTTGCTAACAAATCCCCAAAACGGGGTCAGCGTGCCCAGGGGGGCAAACTTTTTTTGGTAAAAAATTTGGGCAAAAAAAAAAAAAACTTTTGCCTCATCCATTTTTTTTTGGAAAACAAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAATCATCATCAGAATCTGAATCAT