ORFeome > tyms ORF1 – XORFeome v1.0

tyms ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: tyms
Gene ID: 1001390
Gene Page ID: 1001384
ORF Xenbase ID: 17303127

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC129727
Original XGC clone length: 930

Human orthology & disease relationships

NCBI Entrez ID: 7298
Ensembl gene IDs: ENSG00000176890
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 229100,236250,250940,259900,266120,600794,601472,603041,603903,605899,606664,608688,609560

Library Location

Plate ID: GDExl11092
Well Location: F06

Sequences - 5ʹ (forward) EST

Accession: JZ838960
dbEST ID: 79656662
Trimmed Sequence: ATGCCAGTGATTTCCGAGTCCACCGCCGCCTCAAGCTGCCCGGAGCAGGGAGCAGGGAAGGCGGAGAATCGGGACGAGTTGCAGTACTTGGATCAAATCAAATATATTCTAGAGCACGGGCACCGCAAGGAAGATCGCACCGGTACCGGGACCGTCTCTGTGTTCGGCATGCAAGCCCGCTACAGCCTGCGAGATCAGTTTCCTTTGCTGACAACAAAACGTGTCTTCTGGAAAGGAGTGCTAGAAGAACTTCTGTGGTTTGTTAAGGGATGTACCAACTCAAAAGAACTTTCTGCAAAAGGCGTAAAGATTTGGGATGCAAATGGCTCCCGGGAATTTTTGGACAAGCAAGGATTCTCAACCAGAGAGGAAGGAGATCTTGGACCGGTGTATGGTTTTCAGTGGAGGCACTTTGGTGCTGAATACAAAGATACTCATACAGATTACTCGGGCCAAGGTGTCGACCAGCTACAGCATGTAATTGACACAATAAAAAACAACCCAGATGACCGAAGGATTATAATGTGCAGCTGGAACCCTAAAGACATTTCTCTTATGGCTCTGCCGCCTTGTCACACTCTCTGCCAGTTCTACGTAGTTGACAAAGAGTTATCGTGCCAGCTGTACCAGAGATCAGGAGACATGGGGCCTGGGAGTGGCCTTTTAACATCGCTAGTTACGCCTTACTCACTTACATTGATGCTCACGTCCCTGGAATGAACCCGGGAGACTTTGTCCAAACCCTTGGGGGAAGCTCAGGGTTTATCTTAACCCACATTGGAAACCGTTTTAAAAATTCAACCTTTCCAAGAATCCCCCTCCGGC
Full Trace Sequence: CGGGGGCCATATAATGGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCCAGTGATTTCCGAGTCCACCGCCGCCTCAAGCTGCCCGGAGCAGGGAGCAGGGAAGGCGGAGAATCGGGACGAGTTGCAGTACTTGGATCAAATCAAATATATTCTAGAGCACGGGCACCGCAAGGAAGATCGCACCGGTACCGGGACCGTCTCTGTGTTCGGCATGCAAGCCCGCTACAGCCTGCGAGATCAGTTTCCTTTGCTGACAACAAAACGTGTCTTCTGGAAAGGAGTGCTAGAAGAACTTCTGTGGTTTGTTAAGGGATGTACCAACTCAAAAGAACTTTCTGCAAAAGGCGTAAAGATTTGGGATGCAAATGGCTCCCGGGAATTTTTGGACAAGCAAGGATTCTCAACCAGAGAGGAAGGAGATCTTGGACCGGTGTATGGTTTTCAGTGGAGGCACTTTGGTGCTGAATACAAAGATACTCATACAGATTACTCGGGCCAAGGTGTCGACCAGCTACAGCATGTAATTGACACAATAAAAAACAACCCAGATGACCGAAGGATTATAATGTGCAGCTGGAACCCTAAAGACATTTCTCTTATGGCTCTGCCGCCTTGTCACACTCTCTGCCAGTTCTACGTAGTTGACAAAGAGTTATCGTGCCAGCTGTACCAGAGATCAGGAGACATGGGGCCTGGGAGTGGCCTTTTAACATCGCTAGTTACGCCTTACTCACTTACATTGATGCTCACGTCCCTGGAATGAACCCGGGAGACTTTGTCCAAACCCTTGGGGGAAGCTCAGGGTTTATCTTAACCCACATTGGAAACCGTTTTAAAAATTCAACCTTTCCAAGAATCCCCCTCCGGC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCCAGTGATTTCCGAGT

Sequences - 3ʹ (reverse) EST

Accession: JZ838959
dbEST ID: 79656661
Trimmed Sequence: CACAGCCATTTCCATTTTAATAGGGGGGTGGGGGTCGTANCCTTCAATTANAAAATCATCTGCAGTGAAATCGTCAATGTTTTCCACTTGACGTAGGATTTTTAGTTTAGGGAATGGCCGAGGTGATCTTTGAAGCTGAATCTTCAACGGTTCCATGTGGTTTAGATAAACATGAGCATCCCCCAAGGTGTGGACAAAGTCTCCAGGCTTCAATCCAGTGACGTGAGCAATCATGTAAGTGAGTAAGGCGTACCTAGCGATGTTAAAGGGCACTCCCAGGCCCATGTCTCCTGATCTCTGGTACAGCTGGCACGATAACTCTTTGTCAGCTACGTATAACTGGCAGAGAGTGTGACAAGGCGGCAGAGCCATAACAGAAATGTCTTTAGGGTTCCAGCTGCACATTATAATCCTTCGGTCATCTGGGTTGTTTTTTATTGTGTCAATTACATGCTGTAGCTGGTCAACACCTTGGCCCGAGTAGTCAGTATGAATAACTTTGTATTCAGCACCCAACTGCCTCGACGCACCACCACACACCGGCTCCAGAAATCCTTCCACTCTGATTGAAAGGCGTAGCTAATCGAGAAGTCCAAGGAAGCGTGGTGGGGGCTGACTCCTTACCCCCTTTTCCGAAAACTTCTTTTTGATTTGATTACGGCCGGGGCGCAAAACCCCAGAAAATACTCCCAAGCAAATTCCTTTTCCTAACACACCAGGTTTTTGTTATTGCAATTGCAGAAGGAAAAAGGAAAATCACCAGAAAGAGCA
Full Trace Sequence: GGCAACAGGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACACAGCCATTTCCATTTTAATAGGGGGGTGGGGGTCGTANCCTTCAATTANAAAATCATCTGCAGTGAAATCGTCAATGTTTTCCACTTGACGTAGGATTTTTAGTTTAGGGAATGGCCGAGGTGATCTTTGAAGCTGAATCTTCAACGGTTCCATGTGGTTTAGATAAACATGAGCATCCCCCAAGGTGTGGACAAAGTCTCCAGGCTTCAATCCAGTGACGTGAGCAATCATGTAAGTGAGTAAGGCGTACCTAGCGATGTTAAAGGGCACTCCCAGGCCCATGTCTCCTGATCTCTGGTACAGCTGGCACGATAACTCTTTGTCAGCTACGTATAACTGGCAGAGAGTGTGACAAGGCGGCAGAGCCATAACAGAAATGTCTTTAGGGTTCCAGCTGCACATTATAATCCTTCGGTCATCTGGGTTGTTTTTTATTGTGTCAATTACATGCTGTAGCTGGTCAACACCTTGGCCCGAGTAGTCAGTATGAATAACTTTGTATTCAGCACCCAACTGCCTCGACGCACCACCACACACCGGCTCCAGAAATCCTTCCACTCTGATTGAAAGGCGTAGCTAATCGAGAAGTCCAAGGAAGCGTGGTGGGGGCTGACTCCTTACCCCCTTTTCCGAAAACTTCTTTTTGATTTGATTACGGCCGGGGCGCAAAACCCCAGAAAATACTCCCAAGCAAATTCCTTTTCCTAACACACCAGGTTTTTGTTATTGCAATTGCAGAAGGAAAAAGGAAAATCACCAGAAAGAGCA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACACAGCCATTTCCATTTTAATAGG