ORFeome > tyw1 ORF1 – XORFeome v1.0

tyw1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: tyw1
Gene ID: 5955864
Gene Page ID: 5955778
ORF Xenbase ID: 17303139

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC112954
Original XGC clone length: 2208

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11085
Well Location: C09

Sequences - 5ʹ (forward) EST

Accession: #N/A
dbEST ID: #N/A
Trimmed Sequence: #N/A
Full Trace Sequence: CCTCGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCACTGGACAAGTCTACATATGCATGGGACTTTGCCCACACACCTCTGATGCTTTTGAGACTGGTCCTTTGTTTTATTCTTTCTTTGGACCCGTTTGTCCTAAGAATCCACGCCTCACGCCCCGAAACCAAATAGCCCCCATTCGAGCACTTTATGCAAACATTCCAAAGCGATAATCTTCTCGGAAACTACATGCGCCCACAAACGCCCCAACACACCCCCTAAACCCGTTCAATATGTGCCAGTTGCCACGTGTCCCATTTTCTCTGGCCTTTTTACGAATAATTCCCAGGGATTTGCAAAGTTCCTGGCTCATTATCTTCCTCCATCTCGGGCTGCGAGGTACACCATATTTATTAAAAAAGAAAATTCCCCCACATAAAGCACTGGATAGTATTTGCCTTGCTATAATTAACGGCCAGAGTCCCTCCCGCAATTCACTTAACCCCTTTGAAAATCCCAAGAAAGTCGGGCCATAAAAGATTCCCCCAAATTCCGTCAAAGGACTTCCCCACATGCCCTTTTTCATCCGCCTTAAACCAAGGCTCAAGCCCGAACAACATCCCCAAGTATTCTTTTCTCGGCCAAGGCGCTTATAAACGCGCCCGAAAGTAATCTACTCCAGAGGAGGTACTTATGAAATGGGGGAGCCGCCCAAATGATTCCTTTAGAGTTCCTTTTTTGTGGTCACCAAAAACCCCACCCCTGAAAGAAAACACTTCCTTGTGGATACCGGAGAACAAAAAAAAAAAAATTGTGTTTTTTTTTTGGGAAAGAAGAGAACGAAAAACTAGTTTTTTTGTTTGA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGACAAGTCTACAGATGCATGG

Sequences - 3ʹ (reverse) EST

Accession: JZ837653
dbEST ID: 79655355
Trimmed Sequence: GCATCCAGAAATGTCCTTTGTTTTATTCTTTCTTTGGAACCGTTTGTCCAAAGGATCGAAGCCTCTCTCTCTGGAACCAAATAGAGCCCATTCGGGAGTTTTTGCAACATAGTCCAAAGCAGTAAATGTTCTGGAACCCTTGCTCTCGCCGAATGCCTGAATAAGCTCCTGAAACCTTTCATAGTCAATCCAAGTGCACCATTCGCCATTAATCTTGAACTTTTTATGAGCAATGAGCATGCAATTGGAATGTTCATGTTCACATGCAACCTCATAATCAGGAAGGAGGTCTACCAACTCTTCAACAAAACGAATCACCTCTTCATGCCATGGAACATTTGCCATTGTTAGATTACTGGCAGAGCTCTCCCCACAGTAGGTAACCCCCTTCACCTCAATGAAATCTGGCAGTCCAAGAGCAACCAAGTCTGCATAAGCTTTCAGCTCATCCACATTCCAAGCTTTTACTAGGGTCAGTCTGTATACAGTCCTCTGTTGCTTTTCTGCCAAGGCCTTCAAGCTGTCAATGAATCGTTGCCAGAAATCCTTGAACAGTGGGCGATCAATTTTCTTTAGGCTGTCTTTGGTGCTCGCATCCACACTGACATACAACTGTGTAACAGGGCTCAAGAGAACGTATTTCTTCAGGGAACTGAGCATTTGTGACTAAAAAGCTAGATATGTGTTGATTATGAAAAACCCTGAGAAATGTATTTATTTCTGGGTACATAATGGGTTCCCCAACCAAAGACAGGGCACAGTGTTTAACAGCAAGAACCTCCTCCAATCCTTCCAGTTTTCACACCAGAACACCTTTAAAACTGCTTGATCATGTTTTGGTGAATTAAAATAACTTCCTCCCAGAATCTCTCTGGGCTGGTCCTCCTTCCCCTCCCTTTCCTTTCCCAACGGGGTTTGGTATGATGCCTCCCGCCAAAAAAAAAATTTTATAACCACACCCCAAGGGCTTGGTGGTTGGTTTCCTTTGGCGCCAATAACTTTTCATTTCCCAAAAAAAGGGTATTTTTTTGATTGAACCCCCCCCCTTTCCCCCCCCCCCCCAAAAACTTTTTTCCCCCCCTTTCACCAATTTTTAAACCCCAAAAAGAGAAAATTCTTCAAAATCCCATCCTCTTAAAAACCCCTTTGTTTTTTAATAAAAAAAAAACCCCCCCTCCCGCGGGG
Full Trace Sequence: CTGGCAGGGAACAGCTTATGACCATGTTAATACGACTCACTATTAGGGGATACCAGCTTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGCATCCAGAAATGTCCTTTGTTTTATTCTTTCTTTGGAACCGTTTGTCCAAAGGATCGAAGCCTCTCTCTCTGGAACCAAATAGAGCCCATTCGGGAGTTTTTGCAACATAGTCCAAAGCAGTAAATGTTCTGGAACCCTTGCTCTCGCCGAATGCCTGAATAAGCTCCTGAAACCTTTCATAGTCAATCCAAGTGCACCATTCGCCATTAATCTTGAACTTTTTATGAGCAATGAGCATGCAATTGGAATGTTCATGTTCACATGCAACCTCATAATCAGGAAGGAGGTCTACCAACTCTTCAACAAAACGAATCACCTCTTCATGCCATGGAACATTTGCCATTGTTAGATTACTGGCAGAGCTCTCCCCACAGTAGGTAACCCCCTTCACCTCAATGAAATCTGGCAGTCCAAGAGCAACCAAGTCTGCATAAGCTTTCAGCTCATCCACATTCCAAGCTTTTACTAGGGTCAGTCTGTATACAGTCCTCTGTTGCTTTTCTGCCAAGGCCTTCAAGCTGTCAATGAATCGTTGCCAGAAATCCTTGAACAGTGGGCGATCAATTTTCTTTAGGCTGTCTTTGGTGCTCGCATCCACACTGACATACAACTGTGTAACAGGGCTCAAGAGAACGTATTTCTTCAGGGAACTGAGCATTTGTGACTAAAAAGCTAGATATGTGTTGATTATGAAAAACCCTGAGAAATGTATTTATTTCTGGGTACATAATGGGTTCCCCAACCAAAGACAGGGCACAGTGTTTAACAGCAAGAACCTCCTCCAATCCTTCCAGTTTTCACACCAGAACACCTTTAAAACTGCTTGATCATGTTTTGGTGAATTAAAATAACTTCCTCCCAGAATCTCTCTGGGCTGGTCCTCCTTCCCCTCCCTTTCCTTTCCCAACGGGGTTTGGTATGATGCCTCCCGCCAAAAAAAAAATTTTATAACCACACCCCAAGGGCTTGGTGGTTGGTTTCCTTTGGCGCCAATAACTTTTCATTTCCCAAAAAAAGGGTATTTTTTTGATTGAACCCCCCCCCTTTCCCCCCCCCCCCCAAAAACTTTTTTCCCCCCCTTTCACCAATTTTTAAACCCCAAAAAGAGAAAATTCTTCAAAATCCCATCCTCTTAAAAACCCCTTTGTTTTTTAATAAAAAAAAAACCCCCCCTCCCGCGGGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCATCCAGAAATGTCCTTTGT