ORFeome > uap1 ORF1 – XORFeome v1.0

uap1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: uap1
Gene ID: 951697
Gene Page ID: 951690
ORF Xenbase ID: 17303163

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC129598
Original XGC clone length: 1572

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11091
Well Location: F03

Sequences - 5ʹ (forward) EST

Accession: JZ838664
dbEST ID: 79656366
Trimmed Sequence: ATGGATGTGGCAGTTGTTCGTCAGCACCTGTCTGAAGCAGGTCAGAACCACGTGTTACAGTTCTGGGATGAGCTATCCTCGGAACAGAGAAGCAATCTTTTAGAAGAGCTTCATGGTCTAGACTTCCTGGAGTTAAATGGCTTCTTTAAACGAGCAATGGCAGGATTTTCAATCTCATCTTCCCAAGAGAAAGTAGATACAAGAATGGAGGCCGTGCCTCGGGAGGTTCTTGGCAGTGTGACACGGGACAAGGAACATCTACAAGAATGGAAGGCACAAGGTTTAATGGAAATCTCTCGCGGTAAAGTAGCTGTACTACTGCTAGCAGGGGGGCAAGGAACCAGATTGGGAGTGTCCTATCCTAAAGGAATGTATGATGTTGGTCTGCCCTCTCATAAAAGCCTTTACCAGATACAAGCTGAGCGTATCCTGAAACTACAAAAGTTGGCCAGAGAGCTGCATGGTCTAGAATGCACCATTCCCTGGTACATCATGACCAGTGGGCGCACCAAGGAGTCTACTCGTGAATTCTTCCGGAAACATAATTATTTTGGGCTTAGTAAAGAACATGTGATTCTCTTTCGACAAGGAATGCTGCCGGCAATGAACTTTGATGGCGAGATGCTACTTAAAAAAAAAGGAAAAGCTCTCCTGGGCCGCCCGAAGGAGTTGGTGGGGTATAGCGAGAACTTGGTGCACATGGGGGGGTTGGAAGAATTGAAAAGGGAAAGGAAAGGGAGAGAATGAGGGGTAATCCTGGTTGCAAAGACAGGCTGTGGGTTAAAAGT
Full Trace Sequence: TCGTGGGCCCCATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGATGTGGCAGTTGTTCGTCAGCACCTGTCTGAAGCAGGTCAGAACCACGTGTTACAGTTCTGGGATGAGCTATCCTCGGAACAGAGAAGCAATCTTTTAGAAGAGCTTCATGGTCTAGACTTCCTGGAGTTAAATGGCTTCTTTAAACGAGCAATGGCAGGATTTTCAATCTCATCTTCCCAAGAGAAAGTAGATACAAGAATGGAGGCCGTGCCTCGGGAGGTTCTTGGCAGTGTGACACGGGACAAGGAACATCTACAAGAATGGAAGGCACAAGGTTTAATGGAAATCTCTCGCGGTAAAGTAGCTGTACTACTGCTAGCAGGGGGGCAAGGAACCAGATTGGGAGTGTCCTATCCTAAAGGAATGTATGATGTTGGTCTGCCCTCTCATAAAAGCCTTTACCAGATACAAGCTGAGCGTATCCTGAAACTACAAAAGTTGGCCAGAGAGCTGCATGGTCTAGAATGCACCATTCCCTGGTACATCATGACCAGTGGGCGCACCAAGGAGTCTACTCGTGAATTCTTCCGGAAACATAATTATTTTGGGCTTAGTAAAGAACATGTGATTCTCTTTCGACAAGGAATGCTGCCGGCAATGAACTTTGATGGCGAGATGCTACTTAAAAAAAAAGGAAAAGCTCTCCTGGGCCGCCCGAAGGAGTTGGTGGGGTATAGCGAGAACTTGGTGCACATGGGGGGGTTGGAAGAATTGAAAAGGGAAAGGAAAGGGAGAGAATGAGGGGTAATCCTGGTTGCAAAGACAGGCTGTGGGTTAAAAGT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGATGTGGCAGTTGTTCGT

Sequences - 3ʹ (reverse) EST

Accession: JZ838663
dbEST ID: 79656365
Trimmed Sequence: AAAGCTGGTGCCATTCATAACCTGCTGGTGAACTCCATTCTCATCTATTATCAGAGGGGCATGGAATTCCTGATTGTGAACATAGGGCTCCAGACCCTCACCAGCGTAGGAAGTCAAGGGGGAAATTTCGCATTGAATGGGCACGTCGCCAGCATCCTTCATATTTTTCTCGGCATGGTCCTGCGCCGCTCCACACACTCCATTGGTTTGGAGAGGAATGGCTGGAATCCATGTTCCATTTTCATCCACAAAGTGTCCCCCAGCATTGAGCACCCAGCAGTGATGTAGGGACATAAGGGCATGGCGTGCTGTAGTTGGATTGTCCTTTCCATTCTGGCTATCTGCATTTTTCAGAGGTGAAAACTCCTCTTCTCGCAACACCTCAAAAACTACAAATTTTTTGGCAAACTGGAAAATATCAAAAACAAATTTCTCCATTTTCATCCCATTTGGTTTCTCCGGATGTATACGCACACCATGTGTGTCCACATATGGGATTTTCTTCAGCGCCACATGATGCTGCAATTGAGGTTCATGGACCTCCACAACCTCCTGAAGAAACCGTCATGTGAAAAAGTGGTTGGCAATATTTCCTGCGTTGTACATTAGCCGTCCATCTGCACTGCGAGCTTGTGCCGTTTGCCATGTGATCTCACTGTACTTCACCACTTGGTACACACCATCCCACACGGCAAACACACCCCAATGGGTTTCTTTTTGAATCCATCTTTCTCCCCTAACCTTGGCCCCCCCCAAACCTGCCT
Full Trace Sequence: AAAACGGCTATTGACCATGTAATACGACTCACTATANGGGGAATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAAAGCTGGTGCCATTCATAACCTGCTGGTGAACTCCATTCTCATCTATTATCAGAGGGGCATGGAATTCCTGATTGTGAACATAGGGCTCCAGACCCTCACCAGCGTAGGAAGTCAAGGGGGAAATTTCGCATTGAATGGGCACGTCGCCAGCATCCTTCATATTTTTCTCGGCATGGTCCTGCGCCGCTCCACACACTCCATTGGTTTGGAGAGGAATGGCTGGAATCCATGTTCCATTTTCATCCACAAAGTGTCCCCCAGCATTGAGCACCCAGCAGTGATGTAGGGACATAAGGGCATGGCGTGCTGTAGTTGGATTGTCCTTTCCATTCTGGCTATCTGCATTTTTCAGAGGTGAAAACTCCTCTTCTCGCAACACCTCAAAAACTACAAATTTTTTGGCAAACTGGAAAATATCAAAAACAAATTTCTCCATTTTCATCCCATTTGGTTTCTCCGGATGTATACGCACACCATGTGTGTCCACATATGGGATTTTCTTCAGCGCCACATGATGCTGCAATTGAGGTTCATGGACCTCCACAACCTCCTGAAGAAACCGTCATGTGAAAAAGTGGTTGGCAATATTTCCTGCGTTGTACATTAGCCGTCCATCTGCACTGCGAGCTTGTGCCGTTTGCCATGTGATCTCACTGTACTTCACCACTTGGTACACACCATCCCACACGGCAAACACACCCCAATGGGTTTCTTTTTGAATCCATCTTTCTCCCCTAACCTTGGCCCCCCCCAAACCTGCCT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAAAGCTGGTGCCATTCATAAC