ORFeome > uba1 ORF1 – XORFeome v1.0

uba1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: uba1
Gene ID: 6254676
Gene Page ID: 5874063
ORF Xenbase ID: 17303169

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC047256
Original XGC clone length: 3180

Human orthology & disease relationships

NCBI Entrez ID: 7317
Ensembl gene IDs: ENSG00000130985
Directly associated (OMIM) disease MIM numbers: 301830
Indirectly associated (Lage, et al.) disease MIM numbers: 105400,151623,236250,250940,256850,275355,605899,607143,608688,608776,608799

Library Location

Plate ID: GDExl11017
Well Location: B10

Sequences - 5ʹ (forward) EST

Accession: JZ824414
dbEST ID: 79642116
Trimmed Sequence: ATGTCCAGCTCTCCGCTGTCCAAGAAGCGTCGCGTGTCCGGATCTGAGACAAAGACGGGTTCAAACTGCTCTTCCTCCAAGTCTGTGAGCACAGATCAGCCTGCTCCAGCCAACGGGATGGCTCGTAACGGAAATTCCACAGAAATCGATGAAGGTCTCTACTCACGGCAGCTCTATGTATTGGGGCACGATGCCATGAAGCGCATGCAGAACTCCAATGTTCTCATCTCGGGGATGAGTGGACTTGGTGTGGAGATTGCTAAGAATATAATCCTTGCTGGAGTCAAGTCTGTCACTATCCATGATCAGCACAACACGGACTGGGCCGATCTGTCTTCCCAGTTTTACCTGCGGGAGAGCGACATTGGAAAGAACAGAGCGGAGGTGTCGCACCCACGACTGGCTGAGTTAAACACCTATGTGCCCGTGTCTTCATCCACAGACCCCCTGACTGACGAGTTCATGTCTGCCTTCCAGCTGGTTATTCTTACTGGCTCTTCTCTGGAGGAGCAGCTTCAAGTTGGAGACTTTTGTCACAGCCATGACATCAAGTTTATTGTTGCTGACACCAAGGGTCTGTTTGGGCAGCTTTTCTGTGACTTTGGAAAAGAGATGGTTGTGATGGACCCAAATGGGGAGCAACCACTGAGTGCAATGATTTCTATGATTACAAAGGATAACCCCTGGGGTGGTGACCTGTTTGGATGANGCTCGGCACGGCTTTGAGACTGGGGACTTTGTTACATTTACTGAGGTC
Full Trace Sequence: CCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCCAGCTCTCCGCTGTCCAAGAAGCGTCGCGTGTCCGGATCTGAGACAAAGACGGGTTCAAACTGCTCTTCCTCCAAGTCTGTGAGCACAGATCAGCCTGCTCCAGCCAACGGGATGGCTCGTAACGGAAATTCCACAGAAATCGATGAAGGTCTCTACTCACGGCAGCTCTATGTATTGGGGCACGATGCCATGAAGCGCATGCAGAACTCCAATGTTCTCATCTCGGGGATGAGTGGACTTGGTGTGGAGATTGCTAAGAATATAATCCTTGCTGGAGTCAAGTCTGTCACTATCCATGATCAGCACAACACGGACTGGGCCGATCTGTCTTCCCAGTTTTACCTGCGGGAGAGCGACATTGGAAAGAACAGAGCGGAGGTGTCGCACCCACGACTGGCTGAGTTAAACACCTATGTGCCCGTGTCTTCATCCACAGACCCCCTGACTGACGAGTTCATGTCTGCCTTCCAGCTGGTTATTCTTACTGGCTCTTCTCTGGAGGAGCAGCTTCAAGTTGGAGACTTTTGTCACAGCCATGACATCAAGTTTATTGTTGCTGACACCAAGGGTCTGTTTGGGCAGCTTTTCTGTGACTTTGGAAAAGAGATGGTTGTGATGGACCCAAATGGGGAGCAACCACTGAGTGCAATGATTTCTATGATTACAAAGGATAACCCCTGGGGTGGTGACCTGTTTGGATGANGCTCGGCACGGCTTTGAGACTGGGGACTTTGTTACATTTACTGAGGTC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCCAGCTCTCCGCTGT

Sequences - 3ʹ (reverse) EST

Accession: JZ829770
dbEST ID: 79647472
Trimmed Sequence: GCGGATAGTGTAACGTACATACGGCACCTCCACATCCTCGTCTGTCTCATCATTACAGCAAAGCTCAAACACCAGCGCCTTCACGTGCTTCCCGATCTTCTTCTTGGACACTTTAGTCACAATCTCCGTCATCGGTTGCTCCAGCCTCTCCTTTAGCTTGGCCGCAGGCATGAAGAAGGAATAAAGCATGGACACCCCCTGGGACAACATGGTGATCTCCAGCTTGTGTTCATCCTTAAAGTAGTCCAGGAATTGTTTGAGCGTCATCTCTTCGCCGTTGCTCTGCACCCCCTTTACTTCAAATCGGTCCCACAGAGTCCACTCATTGTCGTAGTACTTGTGCTTTGGGGCAGCAATGGGCTCAGAGAAACCAAAGAACGGGAGCGCCAGGTTCAGGAAGCCATTTTTATACGACTCCAACTTCCTGTGGCCCTGAATGATTTTGTACAACTCCAGACACACCAGACCCACCACAGCGGCTGTAGTTGTAGCAATGGCGGGAATGATTTTACCTGCAATCAGTTTGCTCTTGTGTCTATCAGCCGGGGGGATGTCGTAGTTCTCTGCCCTTAGGTTGGAAGCGGCGACNATAAAGTCCATGTGGGAATTTGTGTCATCGTCCTTTTCAAAGTCAATTGGGAACATTCTAAAGCTGCGGAGACTCTCTGGGGGGGGGGAAGTGTATGTTTCAGCTCCCTCCAGGGCGGTTGTCTTCCTAAAAAGGCCTTGAGCGGTTCTGAAACTTCCCGGGTCCCCAATACATGGAAAT
Full Trace Sequence: TGCCGGGTATCAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGCGGATAGTGTAACGTACATACGGCACCTCCACATCCTCGTCTGTCTCATCATTACAGCAAAGCTCAAACACCAGCGCCTTCACGTGCTTCCCGATCTTCTTCTTGGACACTTTAGTCACAATCTCCGTCATCGGTTGCTCCAGCCTCTCCTTTAGCTTGGCCGCAGGCATGAAGAAGGAATAAAGCATGGACACCCCCTGGGACAACATGGTGATCTCCAGCTTGTGTTCATCCTTAAAGTAGTCCAGGAATTGTTTGAGCGTCATCTCTTCGCCGTTGCTCTGCACCCCCTTTACTTCAAATCGGTCCCACAGAGTCCACTCATTGTCGTAGTACTTGTGCTTTGGGGCAGCAATGGGCTCAGAGAAACCAAAGAACGGGAGCGCCAGGTTCAGGAAGCCATTTTTATACGACTCCAACTTCCTGTGGCCCTGAATGATTTTGTACAACTCCAGACACACCAGACCCACCACAGCGGCTGTAGTTGTAGCAATGGCGGGAATGATTTTACCTGCAATCAGTTTGCTCTTGTGTCTATCAGCCGGGGGGATGTCGTAGTTCTCTGCCCTTAGGTTGGAAGCGGCGACNATAAAGTCCATGTGGGAATTTGTGTCATCGTCCTTTTCAAAGTCAATTGGGAACATTCTAAAGCTGCGGAGACTCTCTGGGGGGGGGGAAGTGTATGTTTCAGCTCCCTCCAGGGCGGTTGTCTTCCTAAAAAGGCCTTGAGCGGTTCTGAAACTTCCCGGGTCCCCAATACATGGAAAT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCGGATAGTGTAACGTACAT