ORFeome > ubc ORF1 – XORFeome v1.0

ubc ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: ubc
Gene ID: 6066520
Gene Page ID: 6066016
ORF Xenbase ID: 17303229

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054976
Original XGC clone length: 1830

Human orthology & disease relationships

NCBI Entrez ID: 7316
Ensembl gene IDs: ENSG00000150991
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 194050,223100,259500

Library Location

Plate ID: GDExl11003
Well Location: G10

Sequences - 5ʹ (forward) EST

Accession: JZ839544
dbEST ID: 79657246
Trimmed Sequence: ATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGATACTATTGAGAATGTGAAGGCTAAAATTCAGGATAAAGAAGGCATTCCTCCAGACCAACAAAGGTTGATTTTTGCTGGCAAACAGCTGGAAGATGGTCGAACCCTGTCAGACTATAACATTCAAAAGGAATCCACCCTGCACTTGGTTCTCCGTTTGAGAGGTGGGATGCAAATATTTGTGAAGACCTTAACTGGGAAGACAATTACCCTTGAGGTAGAGCCTAGTGACACAATTGAAAATGTCAAGGCCAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCACCAGAGATTGATTTTTGCTGGCAAGCAACTGGAAGATGGTCGAACTCTGTCTGACTACAACATTCAGAAAGAATCCACCCTGCACTTGGTCCTCCGTCTGAGAGGTGGAATGCAAATATTTGTCAAGACCTTAACTGGGATGACAATTACTCTTGAGGTTGAGCCTAGTGACACTATTGAGAATGTAATGGCCAAAATCCAAGACAAAGAATGGATTCCCCCCTGACCACCAAAGATTGGATTTTGCTTGTAAGCAACTGGGAAGAATGCCGAACACTGGTCTGACTACAATATTCAAAAAGGAATCATCTCAAGCCCTTAGGTCCTTCCTTTTGAAAAGGGTGGGAATGCTGAATATTTTTGAAAAAACTTAAGCTGGGAAAAAAAAATAAACCCCTTGGAGTTTAAACCCGTTGTGACACCATTTGAAAAAATCTAAAAGAACAAAAAAATCCAAGGA
Full Trace Sequence: GGCCCCCAAATAATAGATTTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCAGATATTTGTGAAAACTCTCACTGGGAAGACCATCACACTAGAAGTTGAGCCAAGTGATACTATTGAGAATGTGAAGGCTAAAATTCAGGATAAAGAAGGCATTCCTCCAGACCAACAAAGGTTGATTTTTGCTGGCAAACAGCTGGAAGATGGTCGAACCCTGTCAGACTATAACATTCAAAAGGAATCCACCCTGCACTTGGTTCTCCGTTTGAGAGGTGGGATGCAAATATTTGTGAAGACCTTAACTGGGAAGACAATTACCCTTGAGGTAGAGCCTAGTGACACAATTGAAAATGTCAAGGCCAAAATCCAAGACAAAGAAGGTATTCCCCCTGACCACCAGAGATTGATTTTTGCTGGCAAGCAACTGGAAGATGGTCGAACTCTGTCTGACTACAACATTCAGAAAGAATCCACCCTGCACTTGGTCCTCCGTCTGAGAGGTGGAATGCAAATATTTGTCAAGACCTTAACTGGGATGACAATTACTCTTGAGGTTGAGCCTAGTGACACTATTGAGAATGTAATGGCCAAAATCCAAGACAAAGAATGGATTCCCCCCTGACCACCAAAGATTGGATTTTGCTTGTAAGCAACTGGGAAGAATGCCGAACACTGGTCTGACTACAATATTCAAAAAGGAATCATCTCAAGCCCTTAGGTCCTTCCTTTTGAAAAGGGTGGGAATGCTGAATATTTTTGAAAAAACTTAAGCTGGGAAAAAAAAATAAACCCCTTGGAGTTTAAACCCGTTGTGACACCATTTGAAAAAATCTAAAAGAACAAAAAAATCCAAGGA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCAGATATTTGTGAAAACTCTC

Sequences - 3ʹ (reverse) EST

Accession: #N/A
dbEST ID: #N/A
Trimmed Sequence: #N/A
Full Trace Sequence: GGGGAAAACGGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAATCCCACCCCTCAAACGCAGGACCAGGTGGAGGGTGGATTCTTTCTGTATGTTGTAGTCAGAGAGAGTGCGACCATCTTCCAGCTGCTTGCCAGCAAAGATCAATCTCTGTTGGTCAGGAGGGATTCCTTCCTTATCCTGGATTTTTGCCTTTACATTCTCAATTGTGTCACTGGGCTCAACTTCAAGGGTAATGGTCTTCCCAGTTAAAGTCTTCACAAATATCTGCATGCCACCTCTTATACTAAAGACCAATTGCATAGTGGATTCCCTCTGAATATCATATTCTGACAGCGATCAGCCATCTACCAGTTGCTTTAAAATCATTATTAGCCTCTGCAGGTCTGGACGAATGACTTCTTTATCCTGAATTTTGGCCTTCACATTCTCAATAGTATCACTTGGCTCTACTTCAAGGGTAATTGTCTTCCCAGTTAAAGTCTTCACAAAAATCTGCATGCCGCCACTCTCACGGAAAAATATGTGCATAATGGAATCTCTCTGCATTCAATTTTCTGACACAATCGGGCCATCTTCACTCTAAATTCCATCCTATATTCGCGCTCCGCAGCTAAAACCGGACACTTGTTTCAACTCTTAATTTACAGGTTCCAATCTCCCTTTTTGTTCCTAGGGTCTCAACTTCAAAGGGGAAAAGACATTACAAGAAAGAAGATCTTCAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAATCCCACCCCTCAAACGCA