ORFeome > ube2d1 ORF1 – XORFeome v1.0

ube2d1 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: ube2d1
Gene ID: 954789
Gene Page ID: 954783
ORF Xenbase ID: 17303253

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC084849
Original XGC clone length: 444

Human orthology & disease relationships

NCBI Entrez ID: 7321
Ensembl gene IDs: ENSG00000072401
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 105120,124900,153640,153650,155100,600652,603622,605249,607841,609322

Library Location

Plate ID: GDExl11005
Well Location: C12

Sequences - 5ʹ (forward) EST

Accession: JZ839946
dbEST ID: 79657648
Trimmed Sequence: ATGGCGCTGAAGAGAATACAGAAGGAACTGAATGACTTGCAACGGGACCCTCCGGCTCAGTGCTCTGCCGGCCCAGTAGGAGATGACTTATTCCACTGGCAAGCAACCATTATGGGACCAACTGACAGCCCATATCAAGGGGGTGTCTTTTTCCTCACAATTCACTTTCCAACAGACTATCCTTTCAAACCACCAAAGGTTGCATTCACAACAAAAATCTATCACCCAAACATAAACAGCAATGGAAGTATTTGTCTCGACATACTAAGGTCACAGTGGTCCCCAGCGCTGACTGTGTCAAAAGTTTTGTTGTCAATATGCTCCTTACTTTGTGATCCAAATCCAGACGATCCTTTAGTACCAGATATTGCACAAATCTACAAGTCAGACAAGGAAAAATACAACAGACTAGCAAGAGAATGGACTCAGAAATATGCAATGTT
Full Trace Sequence: CTCGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGCTGAAGAGAATACAGAAGGAACTGAATGACTTGCAACGGGACCCTCCGGCTCAGTGCTCTGCCGGCCCAGTAGGAGATGACTTATTCCACTGGCAAGCAACCATTATGGGACCAACTGACAGCCCATATCAAGGGGGTGTCTTTTTCCTCACAATTCACTTTCCAACAGACTATCCTTTCAAACCACCAAAGGTTGCATTCACAACAAAAATCTATCACCCAAACATAAACAGCAATGGAAGTATTTGTCTCGACATACTAAGGTCACAGTGGTCCCCAGCGCTGACTGTGTCAAAAGTTTTGTTGTCAATATGCTCCTTACTTTGTGATCCAAATCCAGACGATCCTTTAGTACCAGATATTGCACAAATCTACAAGTCAGACAAGGAAAAATACAACAGACTAGCAAGAGAATGGACTCAGAAATATGCAATGTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAATCGTATTACATGGTCATAGCTGTTTCCTGGAAAATAAAGGAAATGTCTAAAATCTCCTAACGTCACAAAAAAGAGGGGGGGGGGGGTGTTTCTTTTTCTTCCGCCCCCGGGTGGGGGGGGGGCGCCCCCCTTTTTGGGTGGTTAAAGAAAAAAACATCACCAAAAAAAAATTTACTTCCTTGAGGCGGTCCTTATCTTATAGCACCCCCCGACCCGAGAGAGAAGAT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGCTGAAGAGAATACAGA

Sequences - 3ʹ (reverse) EST

Accession: JZ839945
dbEST ID: 79657647
Trimmed Sequence: CATTGCATATTTCTGAGTCCATTCTCTTGCTAGTCTGTTGTATTTTTCCTTGTCTGACTTGTAGATTTGTGCAATATCTGGTACTAAAGGATCGTCTGGATTTGGATCACAAAGTAAGGAGCATATTGACAACAAAACTTTTGACACAGTCAGCGCTGGGGACCACTGTGACCTTAGTATGTCGAGACAAATACTTCCATTGCTGTTTATGTTTGGGTGATAGATTTTTGTTGTGAATGCAACCTTTGGTGGTTTGAAAGGATAGTCTGTTGGAAAGTGAATTGTGAGGAAAAAGACACCCCCTTGATATGGGCTGTCAGTTGGTCCCATAATGGTTGCTTGCCAGTGGAATAAGTCATCTCCTACTGGGCCGGCAGAGCACTGAGCCGGAGGGTCCCGTTGCAAGTCATTCAGTTCCTTCTGTATTCTCTTCATCGCCATGG
Full Trace Sequence: GGGAAACGGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACATTGCATATTTCTGAGTCCATTCTCTTGCTAGTCTGTTGTATTTTTCCTTGTCTGACTTGTAGATTTGTGCAATATCTGGTACTAAAGGATCGTCTGGATTTGGATCACAAAGTAAGGAGCATATTGACAACAAAACTTTTGACACAGTCAGCGCTGGGGACCACTGTGACCTTAGTATGTCGAGACAAATACTTCCATTGCTGTTTATGTTTGGGTGATAGATTTTTGTTGTGAATGCAACCTTTGGTGGTTTGAAAGGATAGTCTGTTGGAAAGTGAATTGTGAGGAAAAAGACACCCCCTTGATATGGGCTGTCAGTTGGTCCCATAATGGTTGCTTGCCAGTGGAATAAGTCATCTCCTACTGGGCCGGCAGAGCACTGAGCCGGAGGGTCCCGTTGCAAGTCATTCAGTTCCTTCTGTATTCTCTTCATCGCCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAATCAAAATAAAATCATTATTTGGGGTCCAAAACATAAAACAAAAACATCAATTACAAGTCCTTCTCTAAGAAGGCGAGGGGGGGGGCAACAAAAAAAGAGGCCCCGGGGAAGGGGGGGCCTCCTTTTTTTGTGTTTTTGTGGGCAAACACACTCATACAAATAACACTCTCCTGCCGTGCATGGTATGATGTTGTTTTCACCCCCCCCCACCGC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACATTGCATATTTCTGAGTCCATTC