ORFeome > ube2g1 ORF1 – XORFeome v1.0

ube2g1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: ube2g1
Gene ID: 949500
Gene Page ID: 949493
ORF Xenbase ID: 17303301

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC047985
Original XGC clone length: 513

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11014
Well Location: B08

Sequences - 5ʹ (forward) EST

Accession: JZ824188
dbEST ID: 79641890
Trimmed Sequence: ATGACGGAGTTGCAGTCGGCGCTTTTGCTGCGGAGGCAGCTTGCAGAGTTAAATAAGAATCCAGTGGAAGGTTTTTCAGCAGGCTTAATAAATGACAATGGACTTATACCGATGGGAAGTTCTAATAATCGGCCCACCTGACACATTATATGAGGGTGGGGTTTTCAAGGCTCACCTCACCTTTCCAAGGGATTATCCTCTTCGGCCACCTAAAATGAAATTTATCACAGAAATATGGCACCCAAATGTTGATAAGAATGGAGATGTATGTATTTCCATTCTTCATGAACCTGGTGAAGACAAATATGGCTATGAGAAACCCGAAGAGCGCTGGCTTCCTATCCATACTGTGGAAACCATAATGATCAGTGTAATTTCCATGCTAGCAGACCCTAATGGAGACTCTCCAGCAAATGTGGATGCAGCGAAAGAGTGGCGAGAAGACCGTAATGGAGAATTCAAAAGAAAAGTTGCCCGCTGTGTAAGAAAAAGCCAAGAAACTGCTTTTGAGTT
Full Trace Sequence: AATAATGGATTTTATTTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGACGGAGTTGCAGTCGGCGCTTTTGCTGCGGAGGCAGCTTGCAGAGTTAAATAAGAATCCAGTGGAAGGTTTTTCAGCAGGCTTAATAAATGACAATGGACTTATACCGATGGGAAGTTCTAATAATCGGCCCACCTGACACATTATATGAGGGTGGGGTTTTCAAGGCTCACCTCACCTTTCCAAGGGATTATCCTCTTCGGCCACCTAAAATGAAATTTATCACAGAAATATGGCACCCAAATGTTGATAAGAATGGAGATGTATGTATTTCCATTCTTCATGAACCTGGTGAAGACAAATATGGCTATGAGAAACCCGAAGAGCGCTGGCTTCCTATCCATACTGTGGAAACCATAATGATCAGTGTAATTTCCATGCTAGCAGACCCTAATGGAGACTCTCCAGCAAATGTGGATGCAGCGAAAGAGTGGCGAGAAGACCGTAATGGAGAATTCAAAAGAAAAGTTGCCCGCTGTGTAAGAAAAAGCCAAGAAACTGCTTTTGAGTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAGAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCTATAGTGAGTCGTATAATGGGGTCAAAGCTGTTCCCTGCAGATCTAGCTGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAATTAANTATNTNNATTTNNATTTTTTAATTTTNNAAAANNNCCCTATTTTTTTTTAAAAAATTAATTTTATTTTTTTATAAATAAAAAAAAAAAAAAAATTATNTTTTTTTATTTTTTTTAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGACGGAGTTGCAGTCGG

Sequences - 3ʹ (reverse) EST

Accession: JZ829493
dbEST ID: 79647195
Trimmed Sequence: CTCAAAAGCAGTTTCTTGGCTTTTTCTTACACAGCGGGCAACTTTTCTTTTGAATTCTCCATTACGGTCTTCTCGCCACTCTTTCGCTGCATCCACATTTGCTGGAGAGTCTCCATTAGGGTCTGCTAGCATGGAAATTACACTGATCATTATGGTTTCCACAGTATGGATAGGAAGCCAGCGCTCTTCGGGTTTCTCATAGCCATATTTGTCTTCACCAGGTTCATGAAGAATGGAAATACATACATCTCCATTCTTATCAACATTTGGGTGCCATATTTCTGTGATAAATTTCATTTTAGGTGGCCGAAGAGGATAATCCCTTGGAAAGGTGAGGTGAGCCTTGAAAACCCCACCCTCATATAATGTGTCAGGTGGGCCGATTATTAGAACTTCCCATCGGTATAAGTCATTGTCATCTATTAAGCCTGCTGAAAAACCTTCCACTGGATTCTTATTTAACTCTGCAAGCTGCCTCCGCAGCAAAAGCGCCGACTGCAACTCCGTCATGG
Full Trace Sequence: CGCCAGGGAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCNAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTCAAAAGCAGTTTCTTGGCTTTTTCTTACACAGCGGGCAACTTTTCTTTTGAATTCTCCATTACGGTCTTCTCGCCACTCTTTCGCTGCATCCACATTTGCTGGAGAGTCTCCATTAGGGTCTGCTAGCATGGAAATTACACTGATCATTATGGTTTCCACAGTATGGATAGGAAGCCAGCGCTCTTCGGGTTTCTCATAGCCATATTTGTCTTCACCAGGTTCATGAAGAATGGAAATACATACATCTCCATTCTTATCAACATTTGGGTGCCATATTTCTGTGATAAATTTCATTTTAGGTGGCCGAAGAGGATAATCCCTTGGAAAGGTGAGGTGAGCCTTGAAAACCCCACCCTCATATAATGTGTCAGGTGGGCCGATTATTAGAACTTCCCATCGGTATAAGTCATTGTCATCTATTAAGCCTGCTGAAAAACCTTCCACTGGATTCTTATTTAACTCTGCAAGCTGCCTCCGCAGCAAAAGCGCCGACTGCAACTCCGTCATGGTGCCCACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTTGCCATCAATTTTGTTGCAACGAAACAGTCACTATCAGTCAAATAAAAATCATTATTTGAGAGCCAAAAATAAAAACTGGGCGTCGTTTACACGCCCCCGGGACCGGGGAACTNTCNCCTAACCGGAACGCGGTCGGGGCCAGCAGAAGTAATGAGAAAAACAAAAAGGGGATTTCTGGGGGAGTGTTTGGACGGGGTGTGTTGCTCGGGAAGGT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTCAAAAGCAGTTTCTTGGC