ORFeome > ube2j1 ORF1 – XORFeome v1.0

ube2j1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: ube2j1
Gene ID: 6255502
Gene Page ID: 958458
ORF Xenbase ID: 17303325

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC133182
Original XGC clone length: 909

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11091
Well Location: D04

Sequences - 5ʹ (forward) EST

Accession: JZ838654
dbEST ID: 79656356
Trimmed Sequence: ATGGAGGGTCGGTACAACCTGAAAAGCCCAGCAGTGAAACGGCTGATGAAAGAAGCTGCTGAACTGAGAGACCCAACAGATCACTACCATGCTCAGCCACTAGAGGATAATCTTTTTGAATGGCACTTTACAGTTAGAGGACCCCCTGATTCTGACTTTGATGGAGGTGTTTACCATGGTAGAATTGTCCTGCCACCAGAGTATCCTATGAAGCCTCCAAGCATTATTTTACTAACGGCAAATGGAAGGTTTGAAGTGGGAAAGAAGATCTGTCTGAGTATCTCTGGCCATCATCCTGAAACATGGCAGCCCTCCTGGAGTATAAGAACTGCTTTATTAGCCATAATTGGATTTATGCCTACAAAAGGAGAAGGTGCCATAGGTTCCCTGGATTACACACCCGAAGAAAGAAAAGCTCTTGCCAGAAGATCTCAAGACTACTTCTGTGAAGTATGTGGGGTTAGCATGAAGTCTACTCTACTACCTCTTAGCTCCGGTTCCAGCCAGGCTGATGTGGAAGCGAGAGAGCTTGCCGGACAAATCAGTTTTAAGGCAGAAGTGAACCCACCTGGGAGGTGCTGAAGATCACCCTTATCCGTTCACAGAAAGAACTGAAACAAAGGTTCCGCCACCCCCGAAAACTGACCCTGCGATGTATCCACTCCTGCTGGTTCAGAAACAAATTCAACCTCGTCCCGTAAAAATGTCTCCCAAAAGTCACGTCAAACCCCCTAGGCAAACGAAAGAGAAAACCCCAACCATCAC
Full Trace Sequence: TCGAGGGCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAGGGTCGGTACAACCTGAAAAGCCCAGCAGTGAAACGGCTGATGAAAGAAGCTGCTGAACTGAGAGACCCAACAGATCACTACCATGCTCAGCCACTAGAGGATAATCTTTTTGAATGGCACTTTACAGTTAGAGGACCCCCTGATTCTGACTTTGATGGAGGTGTTTACCATGGTAGAATTGTCCTGCCACCAGAGTATCCTATGAAGCCTCCAAGCATTATTTTACTAACGGCAAATGGAAGGTTTGAAGTGGGAAAGAAGATCTGTCTGAGTATCTCTGGCCATCATCCTGAAACATGGCAGCCCTCCTGGAGTATAAGAACTGCTTTATTAGCCATAATTGGATTTATGCCTACAAAAGGAGAAGGTGCCATAGGTTCCCTGGATTACACACCCGAAGAAAGAAAAGCTCTTGCCAGAAGATCTCAAGACTACTTCTGTGAAGTATGTGGGGTTAGCATGAAGTCTACTCTACTACCTCTTAGCTCCGGTTCCAGCCAGGCTGATGTGGAAGCGAGAGAGCTTGCCGGACAAATCAGTTTTAAGGCAGAAGTGAACCCACCTGGGAGGTGCTGAAGATCACCCTTATCCGTTCACAGAAAGAACTGAAACAAAGGTTCCGCCACCCCCGAAAACTGACCCTGCGATGTATCCACTCCTGCTGGTTCAGAAACAAATTCAACCTCGTCCCGTAAAAATGTCTCCCAAAAGTCACGTCAAACCCCCTAGGCAAACGAAAGAGAAAACCCCAACCATCAC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAGGGTCGGTACAACCTGAA

Sequences - 3ʹ (reverse) EST

Accession: JZ838653
dbEST ID: 79656355
Trimmed Sequence: TAACTCATAGTCAAAGATGTAATCATTTGCCAAGTATACTCTACGGAATATAAGAGCAGCCAATGCTAATGTCAGTACAACAATAAGAACTGCTGATCCAGTATTGCTCCCATTAACCGCACGCTGCTGGACCTGAATGAGTCCTGTGGAGGCTGGAGTTCTCCTCTGCTGTGCACGGCGCTGACGTGGACTTCTGGAGACATTTGTACTGGGAGATGGTGGACTTGTTTCTTGACCAGCAGAGGTTGATACATCTGCAGGCTCAGTCTCAGGGTGTGTGCGAACATTTGGTTCAGTTCTCTCTTGTGACTGATTAAGGTGATTTTCAGCACCTCCAGGTGGGTTCACTTCTGCCTTAAAACTGATTTGTCTGGCGAGCTCTCTCACTTCCGCATCACCCTGGCGGGAACGGGAGCTGAGACGTAATAGAATACACTTCACGCTAACCCCCCATACTTCCCAGAAGTAGTCTGGAAATATTTTAGGCAGGAGGTTTTCTTTCTTCCTTTGGGGGGGGGGGGCAACCGGGGGGCACCTTCTCCTTTTCCTGCATGGATGCGAATAATCACTAAAGGGGGAGTTCTTCGCGCTGCAGGAGGGCGGGGGGGGGGTCGGGATGATTCCCCGGAGAGGGAAAAAAACAAATCTTCTATTCCTACTTTCATTCCTTTCCTTTTCCCTCTTAATTAGGGGGGGTGTTGGAGAGGGGGGGGGGGGGAGGGGCCTCGCCGNCAAAACAAGGGGGGGGGGGGGAAGAGGAGAGGGGGGC
Full Trace Sequence: GGGAAAATGGCTATGACCATGGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATAACTCATAGTCAAAGATGTAATCATTTGCCAAGTATACTCTACGGAATATAAGAGCAGCCAATGCTAATGTCAGTACAACAATAAGAACTGCTGATCCAGTATTGCTCCCATTAACCGCACGCTGCTGGACCTGAATGAGTCCTGTGGAGGCTGGAGTTCTCCTCTGCTGTGCACGGCGCTGACGTGGACTTCTGGAGACATTTGTACTGGGAGATGGTGGACTTGTTTCTTGACCAGCAGAGGTTGATACATCTGCAGGCTCAGTCTCAGGGTGTGTGCGAACATTTGGTTCAGTTCTCTCTTGTGACTGATTAAGGTGATTTTCAGCACCTCCAGGTGGGTTCACTTCTGCCTTAAAACTGATTTGTCTGGCGAGCTCTCTCACTTCCGCATCACCCTGGCGGGAACGGGAGCTGAGACGTAATAGAATACACTTCACGCTAACCCCCCATACTTCCCAGAAGTAGTCTGGAAATATTTTAGGCAGGAGGTTTTCTTTCTTCCTTTGGGGGGGGGGGGCAACCGGGGGGCACCTTCTCCTTTTCCTGCATGGATGCGAATAATCACTAAAGGGGGAGTTCTTCGCGCTGCAGGAGGGCGGGGGGGGGGTCGGGATGATTCCCCGGAGAGGGAAAAAAACAAATCTTCTATTCCTACTTTCATTCCTTTCCTTTTCCCTCTTAATTAGGGGGGGTGTTGGAGAGGGGGGGGGGGGGAGGGGCCTCGCCGNCAAAACAAGGGGGGGGGGGGGAAGAGGAGAGGGGGGC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATAACTCATAGTCAAAGATGTAA