ORFeome > ube2l3 ORF2 – XORFeome v1.0

ube2l3 ORF2 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: ube2l3
Gene ID: 970764
Gene Page ID: 970757
ORF Xenbase ID: 17303349

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC108747
Original XGC clone length: 465

Human orthology & disease relationships

NCBI Entrez ID: 7332
Ensembl gene IDs: ENSG00000185651
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 105830,139300,231300,300000,608902,609535

Library Location

Plate ID: GDExl11085
Well Location: G11

Sequences - 5ʹ (forward) EST

Accession: JZ837675
dbEST ID: 79655377
Trimmed Sequence: ATGGCGGCCAGCAGGAGGCTGATGAAGGAGCTTGAAGAGATCCGCAAATCTGGGATGAAAAATTTCCGTAATATACAGGTGGACGAAGCTAATTTACTGACCTGGCAGGGACTTATCGTTCCAGACAATCCTCCATATGACAAGGGAGCTTTTCGGATTGAAATCAACTTCCCAGCAGAATACCCATTTAAACCCCCCAAGATAACATTTAAAACCAAAATATATCATCCGAATATCGATGAGAAGGGCCAGGTGTGTCTGCCAGTGATCAGTGCTGAAAACTGGAAACCAGCAACCAAAACTGACCAAGTCATCCAGTCACTCATTGCCCTGGTCAACGACCCCCAACCAGAGCACCCACTGCGTGCAGACCTAGCCGAAGAATACTCAAAAGACCGTAAAAAATTCTGTAAGAATGCCGAAGAGTTTACAAAGAAATATGGAGAGAAACGACCAGTGGACTT
Full Trace Sequence: TTCGCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGGCCAGCAGGAGGCTGATGAAGGAGCTTGAAGAGATCCGCAAATCTGGGATGAAAAATTTCCGTAATATACAGGTGGACGAAGCTAATTTACTGACCTGGCAGGGACTTATCGTTCCAGACAATCCTCCATATGACAAGGGAGCTTTTCGGATTGAAATCAACTTCCCAGCAGAATACCCATTTAAACCCCCCAAGATAACATTTAAAACCAAAATATATCATCCGAATATCGATGAGAAGGGCCAGGTGTGTCTGCCAGTGATCAGTGCTGAAAACTGGAAACCAGCAACCAAAACTGACCAAGTCATCCAGTCACTCATTGCCCTGGTCAACGACCCCCAACCAGAGCACCCACTGCGTGCAGACCTAGCCGAAGAATACTCAAAAGACCGTAAAAAATTCTGTAAGAATGCCGAAGAGTTTACAAAGAAATATGGAGAGAAACGACCAGTGGACTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTATCCTGGCAGCTCTAACCCGTGTCTCAAACTCCTTAAAGGTAACAAAGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGGCCAGCAGGAG

Sequences - 3ʹ (reverse) EST

Accession: JZ837674
dbEST ID: 79655376
Trimmed Sequence: GTCCACTGGTCGTTTCTCTCCATATTTCTTTGTAAACTCTTCGGCATTCTTACAGAATTTTTTACGGTCTTTTGAGTATTCTTCGGCTAGGTCTGCACGCAGTGGGTGCTCTGGTTGGGGGTCGTTGACCAGGGCAATGAGTGACTGGATGACTTGGTCAGTTTTGGTTGCTGGTTTCCAGTTTTCAGCACTGATCACTGGCAGACACACCTGGCCCTTCTCATCGATATTCGGATGATATATTTTGGTTTTAAATGTTATCTTGGGGGGTTTAAATGGGTATTCTGCTGGGAAGTTGATTTCAATCCGAAAAGCTCCCTTGTCATATGGAGGATTGTCTGGAACGATAAGTCCCTGCCGGGGCAGTGGATTGGCTTCGGCCGCGGGTAGATTACGGAGATTTTTCATGCGAGATTTGCGGGATCTCGGCAAGCGCCTTCATCAGGGGCGGGGTGGGGGGGCAGGGGGCGAAGTTGTGTGGTCAAGGTGGGCAGGTGGAAAAAAGCAATGGCGCAGCGATTTGGTGGCGAGAGCAGGGCGCGTATGGGTCAGAGAGAGGCGGTATTTGGGGCAAAAAAGAAAAAAAAAAAAAAGACAAATATAGTGCGGAAGAAGGAGGGGGGGAGATGGGGTAGAGGGGGAGGGGCGAGGGGGAAGGGGGGGTGGGGGGTGGGGGGGGGTGAAGGGGGAAACCAAGAGAAAGAGAAAGGCGGCGGGAGGGAGGGTAAAGGGGGGAGGGGGGGGGGGGGGGGGGGAGAAGTGGGGGGAGGGGGGGGGGGGGGGGGGAGGGGGAGGGGGGGGGGGGGGGGGGGAGGGGGGGGGGGGGGGGGGGGGGAGGGGCGGGGGGGGGGGGGGGGAGGGGGGGGGGGGGGGGGGGGGGGGGGGGGAGGGGGGAGGGGAGGGGAGGGGGGGGGAGGGCGGAGGGGGGGGGGGGGGGGGAGAAGGGGAGGGGGGGGGGGGGGGGAGGAGGGGGGGGGAGGGGGGGGGGGAGAGANGAGGAGAGGAGGGGGAGG
Full Trace Sequence: GGGCCAGGGGAACAGCTATTGACCATGTAATACGACTCACTACTAGGGGATATTCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTCCACTGGTCGTTTCTCTCCATATTTCTTTGTAAACTCTTCGGCATTCTTACAGAATTTTTTACGGTCTTTTGAGTATTCTTCGGCTAGGTCTGCACGCAGTGGGTGCTCTGGTTGGGGGTCGTTGACCAGGGCAATGAGTGACTGGATGACTTGGTCAGTTTTGGTTGCTGGTTTCCAGTTTTCAGCACTGATCACTGGCAGACACACCTGGCCCTTCTCATCGATATTCGGATGATATATTTTGGTTTTAAATGTTATCTTGGGGGGTTTAAATGGGTATTCTGCTGGGAAGTTGATTTCAATCCGAAAAGCTCCCTTGTCATATGGAGGATTGTCTGGAACGATAAGTCCCTGCCGGGGCAGTGGATTGGCTTCGGCCGCGGGTAGATTACGGAGATTTTTCATGCGAGATTTGCGGGATCTCGGCAAGCGCCTTCATCAGGGGCGGGGTGGGGGGGCAGGGGGCGAAGTTGTGTGGTCAAGGTGGGCAGGTGGAAAAAAGCAATGGCGCAGCGATTTGGTGGCGAGAGCAGGGCGCGTATGGGTCAGAGAGAGGCGGTATTTGGGGCAAAAAAGAAAAAAAAAAAAAAGACAAATATAGTGCGGAAGAAGGAGGGGGGGAGATGGGGTAGAGGGGGAGGGGCGAGGGGGAAGGGGGGGTGGGGGGTGGGGGGGGGTGAAGGGGGAAACCAAGAGAAAGAGAAAGGCGGCGGGAGGGAGGGTAAAGGGGGGAGGGGGGGGGGGGGGGGGGGAGAAGTGGGGGGAGGGGGGGGGGGGGGGGGGAGGGGGAGGGGGGGGGGGGGGGGGGGAGGGGGGGGGGGGGGGGGGGGGGAGGGGCGGGGGGGGGGGGGGGGAGGGGGGGGGGGGGGGGGGGGGGGGGGGGGAGGGGGGAGGGGAGGGGAGGGGGGGGGAGGGCGGAGGGGGGGGGGGGGGGGGAGAAGGGGAGGGGGGGGGGGGGGGGAGGAGGGGGGGGGAGGGGGGGGGGGAGAGANGAGGAGAGGAGGGGGAGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTCCACTGGTCGTTTCTCT