ORFeome > ube2n ORF1 – XORFeome v1.0

ube2n ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: ube2n
Gene ID: 943755
Gene Page ID: 943748
ORF Xenbase ID: 17303361

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC053797
Original XGC clone length: 459

Human orthology & disease relationships

NCBI Entrez ID: 7334
Ensembl gene IDs: ENSG00000177889
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 223100,300291,300301,300584,307030,308300,603903

Library Location

Plate ID: GDExl11002
Well Location: C02

Sequences - 5ʹ (forward) EST

Accession: JZ839315
dbEST ID: 79657017
Trimmed Sequence: ATGGCCGGGCTGCCCCGCAGGATAATTAAGGAAACCCAGCGTTTACTGGCAGAGCCGGTCCCGGGGATTAAGGCTGAGCCAGATGAAAACAATGCTCGCTTTTTCCACGTGGCTATCGCTGGTCCACAGGATTCACCTTTTGAGGGAGGGTCATTTAAACTTGAATTATTTCTTCCGGAAGAATACCCAATGGCAGCTCCTAAAGTACGATTCATGACCAAAATCTATCACCCTAATGTAGACAAGTTGGGAAGAATATGTCTAGATATTTTGAAAGATAAATGGTCGCCAGCTCTGCAGATTCGTACGGTGCTCCTATCAATTCAGGCTTTGTTAAGTGCTCCCAACCCAGATGACCCTTTAGCCAACGATGTAGCCGAGCAGTGGAAGACAAATGAAGCCCAAGCCATAGAAACAGCCAGAGCATGGACTAGGCTATATGCTTTGAATAATATGTT
Full Trace Sequence: GCTCGAGGGCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCCGGGCTGCCCCGCAGGATAATTAAGGAAACCCAGCGTTTACTGGCAGAGCCGGTCCCGGGGATTAAGGCTGAGCCAGATGAAAACAATGCTCGCTTTTTCCACGTGGCTATCGCTGGTCCACAGGATTCACCTTTTGAGGGAGGGTCATTTAAACTTGAATTATTTCTTCCGGAAGAATACCCAATGGCAGCTCCTAAAGTACGATTCATGACCAAAATCTATCACCCTAATGTAGACAAGTTGGGAAGAATATGTCTAGATATTTTGAAAGATAAATGGTCGCCAGCTCTGCAGATTCGTACGGTGCTCCTATCAATTCAGGCTTTGTTAAGTGCTCCCAACCCAGATGACCCTTTAGCCAACGATGTAGCCGAGCAGTGGAAGACAAATGAAGCCCAAGCCATAGAAACAGCCAGAGCATGGACTAGGCTATATGCTTTGAATAATATGTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTAATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGAAAAAAAAAAAAAAAGTCTCAAAATCTTCACACGGTACAAAGAGAACGGGGGGGAAAAAAACCCCCCCGCCCCCCGCCAAAAGGGGGGGTTCTGTTTTCCCTGGGTGGGATAAGAGAAAAAAAAAAAAAAAGAAAAAAAAACAACAGTGCGGGGTGGTGGTGTTGATGGGAGGGGGAAGGGGCGGGGCGGGAGGAGGGGAAAGGGCGCTCCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCCGGGCTGCCCCGC

Sequences - 3ʹ (reverse) EST

Accession: JZ839314
dbEST ID: 79657016
Trimmed Sequence: CATATTATTCAAAGCATATAGCCTAGTCCATGCTCTGGCTGTTTCTATGGCTTGGGCTTCATTTGTCTTCCACTGCTCGGCTACATCGTTGGCTAAAGGGTCATCTGGGTTGGGAGCACTTAACAAAGCCTGAATTGATAGGAGCACCGTACGAATCTGCAGAGCTGGCGACCATTTATCTTTCAAAATATCTAGACATATTCTTCCCAACTTGTCTACATTAGGGTGATAGATTTTGGTCATGAATCGTACTTTAGGAGCTGCCATTGGGTATTCTTCCGGAAGAAATAATTCAAGTTTAAATGACCCTCCCTCAAAAGGTGAATCCTGTGGACCAGCGATAGCCACGTGGAAAAAGCGAGCATTGTTTTCATCTGGCTCAGCCTTAATCCCCGGGACCGGCTCTGCCAGTAAACGCTGGGTTTCCTTAATTATCCTGCGGGGCAGCCCGGCCATGG
Full Trace Sequence: GGGGCATAGGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACATATTATTCAAAGCATATAGCCTAGTCCATGCTCTGGCTGTTTCTATGGCTTGGGCTTCATTTGTCTTCCACTGCTCGGCTACATCGTTGGCTAAAGGGTCATCTGGGTTGGGAGCACTTAACAAAGCCTGAATTGATAGGAGCACCGTACGAATCTGCAGAGCTGGCGACCATTTATCTTTCAAAATATCTAGACATATTCTTCCCAACTTGTCTACATTAGGGTGATAGATTTTGGTCATGAATCGTACTTTAGGAGCTGCCATTGGGTATTCTTCCGGAAGAAATAATTCAAGTTTAAATGACCCTCCCTCAAAAGGTGAATCCTGTGGACCAGCGATAGCCACGTGGAAAAAGCGAGCATTGTTTTCATCTGGCTCAGCCTTAATCCCCGGGACCGGCTCTGCCAGTAAACGCTGGGTTTCCTTAATTATCCTGCGGGGCAGCCCGGCCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAGTTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTTGGGGCCCGAACATAAGACTGAACATCGTTTTACACAACTGTGAACGGGGGTGTTTCCTGGCAGCTCTGCCCCGTTTTTCAAATCCCAGGGATTTAACAAGGGTACCGGGGGGGGAAAAAAAAAAACAAAAAAAAACGAAAAAACAAAGAGTGGGCGGAGGGGGAAGATAAGGGGAGANCCCCGCCCCCCGAAATATAAAAAAAAAAANA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACATATTATTCAAAGCATATAGCC