ORFeome > ube2s ORF3 – XORFeome v1.0

ube2s ORF3 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: ube2s
Gene ID: 6255548
Gene Page ID: 1008016
ORF Xenbase ID: 17303397

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC130145
Original XGC clone length: 672

Human orthology & disease relationships

NCBI Entrez ID: 27338
Ensembl gene IDs: ENSG00000108106
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11090
Well Location: E04

Sequences - 5ʹ (forward) EST

Accession: JZ838543
dbEST ID: 79656245
Trimmed Sequence: ATGAACTCCAATGTGGAGAATCTGCCGCCCCACATCATCCGCCTAGTGTACAAGGAGGTGACAACACTGACGGCAGACCCACCTGATGGCATTAAAGTCTTCCCCAATGAGGAGGATCTCACAGACCTGCAGGTTACCATCGAGGGCCCTGAAGGGACTCCCTATGCTGGAGGTCTGTTCCGTATGAAGCTCCTACTGGGGAAGGACTTCCCTGCCTCCCCACCCAAGGGCTACTTCCTGACTAAAATCTTCCACCCAAATGTGGGCCCCAATGGCGAGATCTGTGTCAATGTGCTCAAGAGGGACTGGACGGCTGAATTGGGCATACGACATGTGCTGCTGACCATCAAGTGCCTGCTGATCCACCCTAACCCAGAGTCTGCACTCAATGAGGAGGCAGGCCGCCTGCTTTTGGAGAATTATGAAGAGTATGCTGCCCGGGCCCGTCTGCTCACAGAAATCCATGGGGGTGCATGCAGCACCAGCAGCGGGAGGGCTGAGGCTACCCAAGACCTGGCCAGTGGGGCTTCACCCTCCTCTGCTGACCCTATGATCCCAGGGGTCCTAGGGGGAGCTGAGGGTCCCATGGCCAAGAAACATGCATGTGAGCGAGATAAAAAACTGGCAGCCAAAAAAAATTGGGACAGAAGCAAGCACTGAGGCCACTGGTTGCCACTTTTTTTTACCAAGTTTGGATTTAATAAAAAGCTTTTGCTTATCATTTTTGTTCCAACGAACAAGGCTCCTATCATTCCAAATTAAAACCTTTTTATTTCCATCCCACTTTAAATTCCCCCTTAAAGTGGTTCAAAAAAAAAAAAAAAAAAA
Full Trace Sequence: TCGGGGCCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAACTCCAATGTGGAGAATCTGCCGCCCCACATCATCCGCCTAGTGTACAAGGAGGTGACAACACTGACGGCAGACCCACCTGATGGCATTAAAGTCTTCCCCAATGAGGAGGATCTCACAGACCTGCAGGTTACCATCGAGGGCCCTGAAGGGACTCCCTATGCTGGAGGTCTGTTCCGTATGAAGCTCCTACTGGGGAAGGACTTCCCTGCCTCCCCACCCAAGGGCTACTTCCTGACTAAAATCTTCCACCCAAATGTGGGCCCCAATGGCGAGATCTGTGTCAATGTGCTCAAGAGGGACTGGACGGCTGAATTGGGCATACGACATGTGCTGCTGACCATCAAGTGCCTGCTGATCCACCCTAACCCAGAGTCTGCACTCAATGAGGAGGCAGGCCGCCTGCTTTTGGAGAATTATGAAGAGTATGCTGCCCGGGCCCGTCTGCTCACAGAAATCCATGGGGGTGCATGCAGCACCAGCAGCGGGAGGGCTGAGGCTACCCAAGACCTGGCCAGTGGGGCTTCACCCTCCTCTGCTGACCCTATGATCCCAGGGGTCCTAGGGGGAGCTGAGGGTCCCATGGCCAAGAAACATGCATGTGAGCGAGATAAAAAACTGGCAGCCAAAAAAAATTGGGACAGAAGCAAGCACTGAGGCCACTGGTTGCCACTTTTTTTTACCAAGTTTGGATTTAATAAAAAGCTTTTGCTTATCATTTTTGTTCCAACGAACAAGGCTCCTATCATTCCAAATTAAAACCTTTTTATTTCCATCCCACTTTAAATTCCCCCTTAAAGTGGTTCAAAAAAAAAAAAAAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAACTCCAATGTGGAGAATC

Sequences - 3ʹ (reverse) EST

Accession: JZ838542
dbEST ID: 79656244
Trimmed Sequence: CAGTCGCCTCAGTGCTCGCTTCTTGTCCAACTTTTTCTTGGCTGCCAGCTTCTTATCTCGCTCACCTGCATGTTTCTTGGCCATGGGACCCTCAGCTCCCCCTAGGACCCCTGGGATCATAGGGTCAGCAGAGGAGGCTGAAGCCCCACTGGCCAGGTCTTGGGTAGCCTCAGCCCTCCCGCTGCTGGTGCTGCATGCACCCCCATGGATTTCTGTGAGCAGACGGGCCCGGGCAGCATACTCTTCATAATTCTCCAAAAGCAGGCGGCCTGCCTCCTCATTGAGTGCAGACTCTGGGTTAGGGTGGATCAGCAGGCACTTGATGGTCAGCAGCACATGTCGTATGCCCAATTCAGCCGTCCAGTCCCTCTTGAGCACATTGACACAGATCTCGCCATTGGGGCCCACATTTGGGTGGAAGATTTTAGTCAGGAAGTAGCCCTTGGGTGGGGAGGCAGGGAAGTCCTTCCCCACTAGGAGCTTCATAACGAACAGACCTCCAGCATAGGGAATCGCTTCAAGGCCCTCGATGGGAACCTGCAAGTCTGTGAGATCCTCCCTCTTTGTGAAAAACTTTAATGGCATCACGTGAGTCTGCCGGTCGTTGTCGTCACCTCCTGGTACCTAAGGGGAAGAATGTGGGGCGGGCGGAATCCCAAAATAAAAATTCATTGGGGCAGGCTGTGGGGGAACAATTTGGCAATAGAAAAAAAAGCAAAATCTAATAATTTGGTTGGGGGCGAAACAAAAAAAAAAGAAAGAAAAAAAAA
Full Trace Sequence: AAAACGGCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACAGTCGCCTCAGTGCTCGCTTCTTGTCCAACTTTTTCTTGGCTGCCAGCTTCTTATCTCGCTCACCTGCATGTTTCTTGGCCATGGGACCCTCAGCTCCCCCTAGGACCCCTGGGATCATAGGGTCAGCAGAGGAGGCTGAAGCCCCACTGGCCAGGTCTTGGGTAGCCTCAGCCCTCCCGCTGCTGGTGCTGCATGCACCCCCATGGATTTCTGTGAGCAGACGGGCCCGGGCAGCATACTCTTCATAATTCTCCAAAAGCAGGCGGCCTGCCTCCTCATTGAGTGCAGACTCTGGGTTAGGGTGGATCAGCAGGCACTTGATGGTCAGCAGCACATGTCGTATGCCCAATTCAGCCGTCCAGTCCCTCTTGAGCACATTGACACAGATCTCGCCATTGGGGCCCACATTTGGGTGGAAGATTTTAGTCAGGAAGTAGCCCTTGGGTGGGGAGGCAGGGAAGTCCTTCCCCACTAGGAGCTTCATAACGAACAGACCTCCAGCATAGGGAATCGCTTCAAGGCCCTCGATGGGAACCTGCAAGTCTGTGAGATCCTCCCTCTTTGTGAAAAACTTTAATGGCATCACGTGAGTCTGCCGGTCGTTGTCGTCACCTCCTGGTACCTAAGGGGAAGAATGTGGGGCGGGCGGAATCCCAAAATAAAAATTCATTGGGGCAGGCTGTGGGGGAACAATTTGGCAATAGAAAAAAAAGCAAAATCTAATAATTTGGTTGGGGGCGAAACAAAAAAAAAAGAAAGAAAAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACAGTCGCCTCAGTGCTCGCTT