ORFeome > ube2v1 ORF1 – XORFeome v1.0

ube2v1 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: ube2v1
Gene ID: 950457
Gene Page ID: 950452
ORF Xenbase ID: 17303409

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054978
Original XGC clone length: 444

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11001
Well Location: D05

Sequences - 5ʹ (forward) EST

Accession: JZ839160
dbEST ID: 79656862
Trimmed Sequence: ATGGCGGCCACCACGGTCTCGGGCGTTAAAGTTCCTCGTAATTTTCGACTTTTGGAAGAACTTGAAGAAGGCCAGAAAGGAGTGGGCGATGGTACAGTTAGCTGGGGACTTGAAGACGATGAAGACATGACACTCACAAGATGGACTGGCATGATTATCGGACCTCCTAGAACAGGTTATGAAAACCGAATATACAGCCTTAAAGTAGAGTGTGGTCCCAAATACCCAGAATCACCTCCATATGTTAGATTTGTAACAAAAGTTAATATGAGCGGAGTCAATAATTCTAATGGAGTGGTGGACCCCAGGGCCGTCTCCGTTCTAGTAAAATGGCAGAATTCCTATAGCATCAAAGTTGTACTCCAAGAAATGCGGCGTCTAATGATGTCCAAAGAAAATATGAAATTACCACAGCCTCCTGAAGGACAATGCTACAGTAATTT
Full Trace Sequence: GGGGCTCTAGCTCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGGCCACCACGGTCTCGGGCGTTAAAGTTCCTCGTAATTTTCGACTTTTGGAAGAACTTGAAGAAGGCCAGAAAGGAGTGGGCGATGGTACAGTTAGCTGGGGACTTGAAGACGATGAAGACATGACACTCACAAGATGGACTGGCATGATTATCGGACCTCCTAGAACAGGTTATGAAAACCGAATATACAGCCTTAAAGTAGAGTGTGGTCCCAAATACCCAGAATCACCTCCATATGTTAGATTTGTAACAAAAGTTAATATGAGCGGAGTCAATAATTCTAATGGAGTGGTGGACCCCAGGGCCGTCTCCGTTCTAGTAAAATGGCAGAATTCCTATAGCATCAAAGTTGTACTCCAAGAAATGCGGCGTCTAATGATGTCCAAAGAAAATATGAAATTACCACAGCCTCCTGAAGGACAATGCTACAGTAATTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGGCTGTTTCCTGGCAGCTCTGGACCAAGTAACAAATCAAAAAAGGTTACAAGNAGAAANANNNGGGNNGGNGGNNNGGGGGTGNNGTGGNGGTGGGGGGGGTGGGGGGGGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAGAAAAAACCCCCACACACACCTAGAACGAACGCAGGGGGAAGGAGGAAAGAAGNAGAGTGGCCCCCCGCCGCTTC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGGCCACCACGGTCT

Sequences - 3ʹ (reverse) EST

Accession: JZ839159
dbEST ID: 79656861
Trimmed Sequence: ATTACTGTAGCATTGTCCTTCAGGAGGCTGTGGTAATTTCATATTTTCTTTGGACATCATTAGACGCCGCATTTCTTGGAGTACAACTTTGATGCTATAGGAATTCTGCCATTTTACTAGAACGGAGACGGCCCTGGGGTCCACCACTCCATTAGAATTATTGACTCCGCTCATATTAACTTTTGTTACAAATCTAACATATGGAGGTGATTCTGGGTATTTGGGACCACACTCTACTTTAAGGCTGTATATTCGGTTTTCATAACCTGTTCTAGGAGGTCCGATAATCATGCCAGTCCATCTTGTGAGTGTCATGTCTTCATCGTCTTCAAGTCCCCAGCTAACTGTACCATCGCCCACTCCTTTCTGGCCTTCTTCAAGTTCTTCCCAAAGTCGAAAATTACGAGGAACTTTAACGCCCGAGACCGTGGTGGCCGCCATGG
Full Trace Sequence: CGTGAATCNGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCGTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAATTACTGTAGCATTGTCCTTCAGGAGGCTGTGGTAATTTCATATTTTCTTTGGACATCATTAGACGCCGCATTTCTTGGAGTACAACTTTGATGCTATAGGAATTCTGCCATTTTACTAGAACGGAGACGGCCCTGGGGTCCACCACTCCATTAGAATTATTGACTCCGCTCATATTAACTTTTGTTACAAATCTAACATATGGAGGTGATTCTGGGTATTTGGGACCACACTCTACTTTAAGGCTGTATATTCGGTTTTCATAACCTGTTCTAGGAGGTCCGATAATCATGCCAGTCCATCTTGTGAGTGTCATGTCTTCATCGTCTTCAAGTCCCCAGCTAACTGTACCATCGCCCACTCCTTTCTGGCCTTCTTCAAGTTCTTCCCAAAGTCGAAAATTACGAGGAACTTTAACGCCCGAGACCGTGGTGGCCGCCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTTATAAAAAACATTGCTCATCAATTTGTTGCAACGAACAGGTTACTATCAATTTAAATAAAATCATTATTTGGCGGCCGGAGCTTCACAAAGGAAGAAATTTTACATCAACTTGACCGGGCTGTTTGCCTGCCGCCTCTGGCCCGTTGTCTCAAAATCTGTTGATAATAAAANGGANAAAAAAAAAAAAAAAAAAAAAAGNAAGANNGNGGACCGNATNNCGNAAGGCTNNNNTGAAGGGGAGNGGGGTAAAAGAANNNNAAANNAGNANTGANAGGGNGAGAGGGGTGNNACNGGTNGGGGGGATNNN
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAATTACTGTAGCATTGTCCTTCAG