ORFeome > ube2v2 ORF1 – XORFeome v1.0

ube2v2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: ube2v2
Gene ID: 1015108
Gene Page ID: 1015102
ORF Xenbase ID: 17303415

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC042361
Original XGC clone length: 438

Human orthology & disease relationships

NCBI Entrez ID: 7336
Ensembl gene IDs: ENSG00000169139
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 300291,300301,300584,308300

Library Location

Plate ID: GDExl11009
Well Location: D12

Sequences - 5ʹ (forward) EST

Accession: JZ823702
dbEST ID: 79641404
Trimmed Sequence: ATGGCGGTGTGCGCAGGTATTAAGGTGCCTCGTAACTTCCGATTATTGGAAGAGCTTGAAGAAGGGCAGAAAGGTGTGGGTGACGGCACAGTCAGCTGGGGCCTTGAAGATGATGAAGATATGACACTCACTCGGTGGACAGGAATGATAATTGGACCCCCTAGGACAAATTATGAAAATAGAATTTACAGTTTAAGATTAGAATGTGGACCTAAATATCCAGAAGCCCCACCGACAGTTAGGTTTGTAACAAAGATGAATATGAACGGAATAAATAATTCCAATGGCACGGTGGATTATCGAAGCATACCTGTTTTAGCTAAGTGGCAAAACTCCTTTAGCATTAAAGTCTTGCTTCAAGAACTTAGACGCCTCATGATGTCCAAAGAAAATATGAAGCTTCCACAGCCACCAGAAGGACAAACCTACAACAATTT
Full Trace Sequence: GTCAGTAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGGTGTGCGCAGGTATTAAGGTGCCTCGTAACTTCCGATTATTGGAAGAGCTTGAAGAAGGGCAGAAAGGTGTGGGTGACGGCACAGTCAGCTGGGGCCTTGAAGATGATGAAGATATGACACTCACTCGGTGGACAGGAATGATAATTGGACCCCCTAGGACAAATTATGAAAATAGAATTTACAGTTTAAGATTAGAATGTGGACCTAAATATCCAGAAGCCCCACCGACAGTTAGGTTTGTAACAAAGATGAATATGAACGGAATAAATAATTCCAATGGCACGGTGGATTATCGAAGCATACCTGTTTTAGCTAAGTGGCAAAACTCCTTTAGCATTAAAGTCTTGCTTCAAGAACTTAGACGCCTCATGATGTCCAAAGAAAATATGAAGCTTCCACAGCCACCAGAAGGACAAACCTACAACAATTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCCCGTGTCTCAATACACAGAAAATTGTTACAAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTNNNNTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGGTGTGCGCAGGT

Sequences - 3ʹ (reverse) EST

Accession: JZ829012
dbEST ID: 79646714
Trimmed Sequence: ATTGTTGTAGGTTTGTCCTTCTGGTGGCTGTGGAAGCTTCATATTTTCTTTGGACATCATGAGGCGTCTAAGTTCTTGAAGCAAGACTTTAATGCTAAAGGAGTTTTGCCACTTAGCTAAAACAGGTATGCTTCGATAATCCACCGTGCCATTGGAATTATTTATTCCGTTCATATTCATCTTTGTTACAAACCTAACTGTCGGTGGGGCTTCTGGATATTTAGGTCCACATTCTAATCTTAAACTGTAAATTCTATTTTCATAATTTGTCCTAGGGGGTCCAATTATCATTCCTGTCCACCGAGTGAGTGTCATATCTTCATCATCTTCAAGGCCCCAGCTGACTGTGCCGTCACCCACACCTTTCTGCCCTTCTTCAAGCTCTTCCAATAATCGGAAGTTACGAGGCACCTTAATACCTGCGCACACCGCCATGG
Full Trace Sequence: GGGCGGGTATCAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAATTGTTGTAGGTTTGTCCTTCTGGTGGCTGTGGAAGCTTCATATTTTCTTTGGACATCATGAGGCGTCTAAGTTCTTGAAGCAAGACTTTAATGCTAAAGGAGTTTTGCCACTTAGCTAAAACAGGTATGCTTCGATAATCCACCGTGCCATTGGAATTATTTATTCCGTTCATATTCATCTTTGTTACAAACCTAACTGTCGGTGGGGCTTCTGGATATTTAGGTCCACATTCTAATCTTAAACTGTAAATTCTATTTTCATAATTTGTCCTAGGGGGTCCAATTATCATTCCTGTCCACCGAGTGAGTGTCATATCTTCATCATCTTCAAGGCCCCAGCTGACTGTGCCGTCACCCACACCTTTCTGCCCTTCTTCAAGCTCTTCCAATAATCGGAAGTTACGAGGCACCTTAATACCTGCGCACACCGCCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAATCAAAATAAAATCATTATTTGGGGCAAAAGCTAAAGACTGGACGTCGTTTTACACCCGCGGTGAACTGGGAAGNNAACGGGCAAGAGTCGGATCAGATGTTCTCTGAGCGGTGGAAAATGACAAAAGTGTTCCCCAGTTTTTCACTCAGATTATGCGAAAAGAAGAGTCGGGANCGGTTTTTCNTCGCTTCTGGAANTAAAATACCCANA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAATTGTTGTAGGTTTGTCCTTCTG