ORFeome > ube3a ORF1 – XORFeome v1.0

ube3a ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: ube3a
Gene ID: 948562
Gene Page ID: 948556
ORF Xenbase ID: 17303433

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC045002
Original XGC clone length: 2727

Human orthology & disease relationships

NCBI Entrez ID: 7337
Ensembl gene IDs: ENSG00000114062,LRG_15
Directly associated (OMIM) disease MIM numbers: 105830
Indirectly associated (Lage, et al.) disease MIM numbers: 105830,139300,231300,270200,300000,307030,608902,609535

Library Location

Plate ID: GDExl11012
Well Location: G10

Sequences - 5ʹ (forward) EST

Accession: JZ824028
dbEST ID: 79641730
Trimmed Sequence: ATGAGTTCCCCACATAAGAGGCGGCAGCAGGAGAGAGCGGGAGCCCCGGAGCCTGAGGAGAGGAAGACCAACACCCCCCGCAGCAGCTCGGAACACAGCCCTGAAGGAGACAGATCTCCAGCAGACCCTCATTCAGAAAATCTAGAAAATAGCCGAATGAAGCGAGCAGCTGCAAAGCATCTAATAGAACGCTACTACCACCAGTTAACTGAGGGTTGTGGAAATGAAACCTGCACGAATGAATTTTGTGCTTCCTGTCCCACTTTTCTGCGTATGGATAATAATGCAGCAGCCATTAAGGCCCTCGAGTTGTATAAGGTTAATGCGAAACTCTGTGATCCTCATCCCTCCAAGAAAGGAACAAGCTCATCTTATCTAGAGAATAATTCCAAAAGCGCCCATAACAACTCCTGCACAGAAAGAAAGATGAATAAGAAAGACCTACACGGACCCAGAGACGACTTTAGAGATGTCACTTTCTTATCAGAAGAAAAAGTGTATGAAATTCTGGAATTGTGTAGAGAAAAAGAAGACTACTCTCCTTTAATTCGAGTAATCGGGAGAGTTTTTTCTAGTGCAGAAGCTTTGGTTCAAAGTTTCCGAAAAGCAAAACACCATACAAAAGAAGAGCTAAAATCCTTGCAAGAAAAGGATGAAGATAAGGATGAAGATGAAAAGGAAAAAGCTGCATCATCTGCTGCTGNCATGGAAGAAGATTCTGGAGCATCATCCTCAAGGNTTATGTGACATTTCACTTGGAGGACACAACATACCGAAAACTGGGGC
Full Trace Sequence: CAAATATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAGTTCCCCACATAAGAGGCGGCAGCAGGAGAGAGCGGGAGCCCCGGAGCCTGAGGAGAGGAAGACCAACACCCCCCGCAGCAGCTCGGAACACAGCCCTGAAGGAGACAGATCTCCAGCAGACCCTCATTCAGAAAATCTAGAAAATAGCCGAATGAAGCGAGCAGCTGCAAAGCATCTAATAGAACGCTACTACCACCAGTTAACTGAGGGTTGTGGAAATGAAACCTGCACGAATGAATTTTGTGCTTCCTGTCCCACTTTTCTGCGTATGGATAATAATGCAGCAGCCATTAAGGCCCTCGAGTTGTATAAGGTTAATGCGAAACTCTGTGATCCTCATCCCTCCAAGAAAGGAACAAGCTCATCTTATCTAGAGAATAATTCCAAAAGCGCCCATAACAACTCCTGCACAGAAAGAAAGATGAATAAGAAAGACCTACACGGACCCAGAGACGACTTTAGAGATGTCACTTTCTTATCAGAAGAAAAAGTGTATGAAATTCTGGAATTGTGTAGAGAAAAAGAAGACTACTCTCCTTTAATTCGAGTAATCGGGAGAGTTTTTTCTAGTGCAGAAGCTTTGGTTCAAAGTTTCCGAAAAGCAAAACACCATACAAAAGAAGAGCTAAAATCCTTGCAAGAAAAGGATGAAGATAAGGATGAAGATGAAAAGGAAAAAGCTGCATCATCTGCTGCTGNCATGGAAGAAGATTCTGGAGCATCATCCTCAAGGNTTATGTGACATTTCACTTGGAGGACACAACATACCGAAAACTGGGGC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGTTCCCCACATAAGAG

Sequences - 3ʹ (reverse) EST

Accession: JZ829336
dbEST ID: 79647038
Trimmed Sequence: GAGCATACCAAACCCCTTTGCATAAGTGATGGCCTTTAACAATCTCTCCTTCAGTTTCGCTTTACTTGAGTACTCCGGAAGCAAAAGGACATTAAAGCAAGTATGAGATGTTGGTAACCTGTCTGTATCAGGGCCGTTTTTGGCTATAATCATCTTTAATTTGCCTAGCCCACCCACAGGGGCTCTGTCCGTCCCTGTTGTAAATTGCAAGAACAATCTTTTCTGTTCCTCAGTGAAAGAATTTACAATTTCCCAAAACTCTTTGATAATATTTGAATCTCTGGTATAACCACCGTCATATTCTGTAGTATCTTTCAGAGCTTGGAAATCTACATTCCTACTTCCACAAATAAGAAGTTCAATTTCCTCTGGTCTAAACAGATATTTTAAAGGTGACTCATTGGTAACCATGTGAAAGCCCCTCCTGAAGGCTTTAAACTGCTTTTCCGCTGATTTATTTAGAATAAAGTCTGTATATAGATTGACAAATTCCTTTCTGTTCTCATTTGTAATTGGGATTTTATCTCCATTTTCCTTTAGGTCGTGCATTAACGGATTTCAAAAGAGGTCAGTCTGAGAGATCTGGAAACGTCATCATCATATCATCTTCAACACTGCCTTCATACTCCAACAAATCTTTTAAACTCTGAATAAGGAACCGAAAGAAAAATCTGCAAGGGTCTTGGAAGGGTTCCCTTTTTTTCCCCATTAATTTTTTCTAAATACCAAACCATTTGGAAAAAAAGGCACCTTCCTA
Full Trace Sequence: GCGTCAGGCATCAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGAGCATACCAAACCCCTTTGCATAAGTGATGGCCTTTAACAATCTCTCCTTCAGTTTCGCTTTACTTGAGTACTCCGGAAGCAAAAGGACATTAAAGCAAGTATGAGATGTTGGTAACCTGTCTGTATCAGGGCCGTTTTTGGCTATAATCATCTTTAATTTGCCTAGCCCACCCACAGGGGCTCTGTCCGTCCCTGTTGTAAATTGCAAGAACAATCTTTTCTGTTCCTCAGTGAAAGAATTTACAATTTCCCAAAACTCTTTGATAATATTTGAATCTCTGGTATAACCACCGTCATATTCTGTAGTATCTTTCAGAGCTTGGAAATCTACATTCCTACTTCCACAAATAAGAAGTTCAATTTCCTCTGGTCTAAACAGATATTTTAAAGGTGACTCATTGGTAACCATGTGAAAGCCCCTCCTGAAGGCTTTAAACTGCTTTTCCGCTGATTTATTTAGAATAAAGTCTGTATATAGATTGACAAATTCCTTTCTGTTCTCATTTGTAATTGGGATTTTATCTCCATTTTCCTTTAGGTCGTGCATTAACGGATTTCAAAAGAGGTCAGTCTGAGAGATCTGGAAACGTCATCATCATATCATCTTCAACACTGCCTTCATACTCCAACAAATCTTTTAAACTCTGAATAAGGAACCGAAAGAAAAATCTGCAAGGGTCTTGGAAGGGTTCCCTTTTTTTCCCCATTAATTTTTTCTAAATACCAAACCATTTGGAAAAAAAGGCACCTTCCTA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGAGCATACCAAACCCCTT