ORFeome > ubp1 ORF1 – XORFeome v1.0

ubp1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: ubp1
Gene ID: 958764
Gene Page ID: 958758
ORF Xenbase ID: 17303475

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC141752
Original XGC clone length: 1413

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11091
Well Location: H09

Sequences - 5ʹ (forward) EST

Accession: JZ838861
dbEST ID: 79656563
Trimmed Sequence: ATGTTGTTTTGGCACAGCCAACCAGAACATTACTGGCCCACTCCGGCCGAGCACTACCAGAACCCTCCGAGCGGCATCTACAGAGAAACTATACAACTTCCATTCCTGAAGCAAGAAGACCAGCCACCCATCATCCCACTATGTCCAGCCTTCCAGTGCATCCTGGGTGCACCAAGTTCTCCAGCCATCAAGATGCATGAAGAGACCCTCACCTACCTCAACCAGGGTCAGTCCTATGAGATCCGCATGCTGAGTAACTGGAAGGGTGTTGGAGAACTCTCTGAGGGTCGCCGACTGCTGAGGAGTGTGGTCAGAGTGGTCTTCCATGACCGTCGCTTGCAGTACAGCGAGAGGCAGCAGTTGGAGAGCTGGCAGTTGAATCACCCAGGGGATCGAATCTTAGATCTAGATGTCCCATTGACCGTAGGGGTAACAGACCCATTGGTAAACCCCAATACTTTGAACACCATTGAGTTCCTTTGGGACCCAAGCAAAAGGACATCTGTCTTTATCCAGGTTCACTGTATAAGCACTGAGTTCACCCAGAAGAAAAATGGAGGAGAAAAGGGGGCCCCTTTCCGGATTCAGGTGGACACATATNAGGGAGATGCTAATGGAGGATTTACAGACAATCTGTACTCATGTAGCTGCCCAGTTAAGGTTTTTAAGCCCAAAGTGCTGATCGGAAACAGAAGACTGACCGGAAGAAGGTGGGAGAGGCTTTCCCCTTCTTAAACGGGAAAAATTACAACCCCGCCGGTTGAAAACCCTGGTCCCGGACTGAGATTCATTTCCCTTTGGTCAAAAATTTTGGAAACCC
Full Trace Sequence: GCTCGAGGGCCCAATAANTGATTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTTGTTTTGGCACAGCCAACCAGAACATTACTGGCCCACTCCGGCCGAGCACTACCAGAACCCTCCGAGCGGCATCTACAGAGAAACTATACAACTTCCATTCCTGAAGCAAGAAGACCAGCCACCCATCATCCCACTATGTCCAGCCTTCCAGTGCATCCTGGGTGCACCAAGTTCTCCAGCCATCAAGATGCATGAAGAGACCCTCACCTACCTCAACCAGGGTCAGTCCTATGAGATCCGCATGCTGAGTAACTGGAAGGGTGTTGGAGAACTCTCTGAGGGTCGCCGACTGCTGAGGAGTGTGGTCAGAGTGGTCTTCCATGACCGTCGCTTGCAGTACAGCGAGAGGCAGCAGTTGGAGAGCTGGCAGTTGAATCACCCAGGGGATCGAATCTTAGATCTAGATGTCCCATTGACCGTAGGGGTAACAGACCCATTGGTAAACCCCAATACTTTGAACACCATTGAGTTCCTTTGGGACCCAAGCAAAAGGACATCTGTCTTTATCCAGGTTCACTGTATAAGCACTGAGTTCACCCAGAAGAAAAATGGAGGAGAAAAGGGGGCCCCTTTCCGGATTCAGGTGGACACATATNAGGGAGATGCTAATGGAGGATTTACAGACAATCTGTACTCATGTAGCTGCCCAGTTAAGGTTTTTAAGCCCAAAGTGCTGATCGGAAACAGAAGACTGACCGGAAGAAGGTGGGAGAGGCTTTCCCCTTCTTAAACGGGAAAAATTACAACCCCGCCGGTTGAAAACCCTGGTCCCGGACTGAGATTCATTTCCCTTTGGTCAAAAATTTTGGAAACCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTTGTTTTGGCACAGCCAACC

Sequences - 3ʹ (reverse) EST

Accession: JZ838860
dbEST ID: 79656562
Trimmed Sequence: TCGCAGGATGCAGTGAAAGCTGTCGGAGTTCTGCAGTTTCTGTAGGGAGGCCATGAAGCAGGACTCATCGGGCATATGTCTTACCATAGTGTCACTCAGGAGAATGTGAATCCCATGAGGTCCCGTCCTGGAAATCTGCTGGATGTGATTGGCCGGGACAGAGAAGAGATCAGCCACCTTAGTGGTCAGTTCAGCAGCGGTAATTTCCTCCAAGTACAGCTCCTGATAGACTGTCTGGCTGGTGTCATCAGTGGTTTTCTTCTCCGGTGTATCTGTGGCGATGTACAGAGTGAGACGTGGGCGCACAGACCTTGCACTGAGCGAATGAGCCAGGCGAATCCCATCGGCCACTCCGCAGATCTGAGTGAGGTCTTTGCGAGACAACTTCAAAAGGTCGGCCCCTGTAAAATTGGAAAAGGTCCGGCAGTAGTTGGAAAAGCGGTTTCTCACAAGCCATTGCTGCGTCTCTGAGATGGAAGAGGAAGGACTGAGACTCTCTCCTGAGCTTTCCGTGGAACTATCTGAGGCACACACAGGAGATGCGCAGACCCTCTCTGGGGGTGGGCATTCTGAAGCAACCTGGGGTGGGTTGGGGGGTTTCGGGGGGTTTCAGTATCTTGGCGAAGGAAGCACTCAGTCAGGACCAGGGTTCCAAAAGGCTGGGCTGGGATCTTGTCCCGTTCCTAAACGGGAACGCTTCTCTCACCTTCCTCCCGGCCCAGTTTTTTCGGTTTCCCTATTCAATCACCCTTTGTTGGGCTTTAAA
Full Trace Sequence: GGGAAACGGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATCGCAGGATGCAGTGAAAGCTGTCGGAGTTCTGCAGTTTCTGTAGGGAGGCCATGAAGCAGGACTCATCGGGCATATGTCTTACCATAGTGTCACTCAGGAGAATGTGAATCCCATGAGGTCCCGTCCTGGAAATCTGCTGGATGTGATTGGCCGGGACAGAGAAGAGATCAGCCACCTTAGTGGTCAGTTCAGCAGCGGTAATTTCCTCCAAGTACAGCTCCTGATAGACTGTCTGGCTGGTGTCATCAGTGGTTTTCTTCTCCGGTGTATCTGTGGCGATGTACAGAGTGAGACGTGGGCGCACAGACCTTGCACTGAGCGAATGAGCCAGGCGAATCCCATCGGCCACTCCGCAGATCTGAGTGAGGTCTTTGCGAGACAACTTCAAAAGGTCGGCCCCTGTAAAATTGGAAAAGGTCCGGCAGTAGTTGGAAAAGCGGTTTCTCACAAGCCATTGCTGCGTCTCTGAGATGGAAGAGGAAGGACTGAGACTCTCTCCTGAGCTTTCCGTGGAACTATCTGAGGCACACACAGGAGATGCGCAGACCCTCTCTGGGGGTGGGCATTCTGAAGCAACCTGGGGTGGGTTGGGGGGTTTCGGGGGGTTTCAGTATCTTGGCGAAGGAAGCACTCAGTCAGGACCAGGGTTCCAAAAGGCTGGGCTGGGATCTTGTCCCGTTCCTAAACGGGAACGCTTCTCTCACCTTCCTCCCGGCCCAGTTTTTTCGGTTTCCCTATTCAATCACCCTTTGTTGGGCTTTAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATCGCAGGATGCAGTGAAA