ORFeome > ubqln4 ORF1 – XORFeome v1.0

ubqln4 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: ubqln4
Gene ID: 922997
Gene Page ID: 922981
ORF Xenbase ID: 17303487

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC047982
Original XGC clone length: 1800

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11013
Well Location: F06

Sequences - 5ʹ (forward) EST

Accession: JZ824047
dbEST ID: 79641749
Trimmed Sequence: ATGGCGGAGAGCGGCGCTGATGGTGCGGCCTCTGGTACTATCGGGCAGGCTCCGGCTAAAGGACTTATTCGTGTCACCGTCAAGACGCCCAAGGACAAGGAGGAGATTGTCATTGGGGAAACGGCGTGTGTCCTGGAGTTCAAGGAAGAGATCTCCAGGCGGTTCAAAGCGAAACGGGATCAGCTGGTTCTGATCTTTGCCGGGAAGATCCTGAAAGATGGGGACACGCTGAACCAGCACGGCATCAAAGATGGCCTCACCGTACATTTAGTCATCAAAACTGCACAGAAATCCCAGGACCCATCCGGGGTTTCCTCTGCTTCTGATGCTGCTGCTTCCAACTCCTCCCCACAGACAGGTAACGCTACCTCCCCGACACCCGCTACTGGAAACAGCTCCTCCGAGGGGAGTGGAGGAACCAACAGAGCTGATGGTGCCAGCACTGCTGCAAATGGATCTCCCGCTGCCCCAAACCTCCTGTCTGGTTTTGGAGGTTTGGCCGGATTGGGCAACTTGGGCATGGGATCGGCCAACTTCATGGAACTGCAGCAGCAGATGCAGCGACAGCTCATGTCCAGTCCTGAGATGCTGTCCCAGATTATGGAGAACCCCCTGGTGCAAAACATGATGTCTAACCCCGACCTCATGAGGCAGATGATCATGGCCAACCCCCAGATGCAGCAACTGATGGAGAGGAACCCGGAGATCAGCCACATGTTTGAACACCCAGAGCTGATGAGGCAGACTATGGAGTTAGCCCCAAAACCCTGCTATGATGCCAGGAGATGAATGAGGGACCCAGGACCGGAGCCCCTCCAGTAAACCTAAAAAAGCCATCCCG
Full Trace Sequence: TAATGATTTTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGGAGAGCGGCGCTGATGGTGCGGCCTCTGGTACTATCGGGCAGGCTCCGGCTAAAGGACTTATTCGTGTCACCGTCAAGACGCCCAAGGACAAGGAGGAGATTGTCATTGGGGAAACGGCGTGTGTCCTGGAGTTCAAGGAAGAGATCTCCAGGCGGTTCAAAGCGAAACGGGATCAGCTGGTTCTGATCTTTGCCGGGAAGATCCTGAAAGATGGGGACACGCTGAACCAGCACGGCATCAAAGATGGCCTCACCGTACATTTAGTCATCAAAACTGCACAGAAATCCCAGGACCCATCCGGGGTTTCCTCTGCTTCTGATGCTGCTGCTTCCAACTCCTCCCCACAGACAGGTAACGCTACCTCCCCGACACCCGCTACTGGAAACAGCTCCTCCGAGGGGAGTGGAGGAACCAACAGAGCTGATGGTGCCAGCACTGCTGCAAATGGATCTCCCGCTGCCCCAAACCTCCTGTCTGGTTTTGGAGGTTTGGCCGGATTGGGCAACTTGGGCATGGGATCGGCCAACTTCATGGAACTGCAGCAGCAGATGCAGCGACAGCTCATGTCCAGTCCTGAGATGCTGTCCCAGATTATGGAGAACCCCCTGGTGCAAAACATGATGTCTAACCCCGACCTCATGAGGCAGATGATCATGGCCAACCCCCAGATGCAGCAACTGATGGAGAGGAACCCGGAGATCAGCCACATGTTTGAACACCCAGAGCTGATGAGGCAGACTATGGAGTTAGCCCCAAAACCCTGCTATGATGCCAGGAGATGAATGAGGGACCCAGGACCGGAGCCCCTCCAGTAAACCTAAAAAAGCCATCCCG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGGAGAGCGGCGCT

Sequences - 3ʹ (reverse) EST

Accession: JZ829357
dbEST ID: 79647059
Trimmed Sequence: GGAGGGCTGGGAGCCCAACAGTCTCTCGATGGCTGCATTGATGTCTCCGCCAGTCGCTATAAGGGCCTGCACGTTTGCTTCCCGGTTGATAAAGCCCATGGCATTTAGTTGGTCCAGCTGAGACTGGAAACGGACCTCGGGGTTCTGCACCTGAGAATTACCCCCGGCCAAAAGCTGGATCATCTGCTGCATCATCTGTTGCTGGGGATTACTGCTGCTGCCCCCTGATGGAGAGGCACTTGCTGGCGAGGAGGAGGAGGCGGGGTTATCAGGGGGCGTGCTTCCGCCAGATGTGGGTGGCACCCCAGGAATGCCAAAAGAACCAAGGCTGGATATCAGGCCCGGGGCCTCCGTCTGCAGTGATTGAAGTCCCTGTTGGATCTGGAGCAGCGCCTGCATCGCCCTGGGGTTGCTCATTACTGACATAGATTCTGGGTTCTGCATCTGCTGCAGGAAGACTGGCAGTTGGTGTCGGAGCTGTTCCTGTAGCTGTGGGTTCCCAGAGAAGATTGGAATGTTCCCCATCATCTGTGCAGTAAATTCCGGGTTCTGTGCCAGGGCCCGCATCATACTCCGCGTGTAGGGGGCAGAAATCATACTCCTGTATTAACTGGGGGTTTTCAGGGATCTGCTGCAACACGCCTTTGCATTTCTGGGCCTGTTAATCCGCGCCTGGAACCCAAAATGGGGCACCTTGTAGTCCAAAGGGGGGTTTGGGAAACAGGTGGGGGGCCCCTTTTTGGCTGGGGGGGGTAAA
Full Trace Sequence: TGACGAGTAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGGAGGGCTGGGAGCCCAACAGTCTCTCGATGGCTGCATTGATGTCTCCGCCAGTCGCTATAAGGGCCTGCACGTTTGCTTCCCGGTTGATAAAGCCCATGGCATTTAGTTGGTCCAGCTGAGACTGGAAACGGACCTCGGGGTTCTGCACCTGAGAATTACCCCCGGCCAAAAGCTGGATCATCTGCTGCATCATCTGTTGCTGGGGATTACTGCTGCTGCCCCCTGATGGAGAGGCACTTGCTGGCGAGGAGGAGGAGGCGGGGTTATCAGGGGGCGTGCTTCCGCCAGATGTGGGTGGCACCCCAGGAATGCCAAAAGAACCAAGGCTGGATATCAGGCCCGGGGCCTCCGTCTGCAGTGATTGAAGTCCCTGTTGGATCTGGAGCAGCGCCTGCATCGCCCTGGGGTTGCTCATTACTGACATAGATTCTGGGTTCTGCATCTGCTGCAGGAAGACTGGCAGTTGGTGTCGGAGCTGTTCCTGTAGCTGTGGGTTCCCAGAGAAGATTGGAATGTTCCCCATCATCTGTGCAGTAAATTCCGGGTTCTGTGCCAGGGCCCGCATCATACTCCGCGTGTAGGGGGCAGAAATCATACTCCTGTATTAACTGGGGGTTTTCAGGGATCTGCTGCAACACGCCTTTGCATTTCTGGGCCTGTTAATCCGCGCCTGGAACCCAAAATGGGGCACCTTGTAGTCCAAAGGGGGGTTTGGGAAACAGGTGGGGGGCCCCTTTTTGGCTGGGGGGGGTAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGAGGGCTGGGAGCCCAA