ORFeome > ubxn2b ORF1 – XORFeome v1.0

ubxn2b ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: ubxn2b
Gene ID: 6252818
Gene Page ID: 6457457
ORF Xenbase ID: 17303523

ORF full-length analysis tests

Full-Length confidence: unknown
Original XGC clone accession: BC122501
Original XGC clone length: 1053

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11087
Well Location: A10

Sequences - 5ʹ (forward) EST

Accession: JZ838059
dbEST ID: 79655761
Trimmed Sequence: ATGGAGGAAAGAGAGAATTCCGAGGAAGGGGACGACGGTGCGGGCGAAGAAGAGGAGGAGGACCAAGGATCTGGCGAGGACGGAGGCGAGGTGGGGGCGGAGAGAGAGCAAGAGGCGGAACTAAAGGATTCGCTCAGGCCCTCAGTGCTGGACCTGCAGTTGGCACTGGCTCGACTGTGTGAGGATGAGTACCAAGATCAGCCATCAAAAATGCCTGTATTAGGGCTGCAAATTAAAGATCATCAATTTGAAAGATCTTTTTCAGGTAATGGCAAAGTCCCTTCTCCAGGCAAAATTGTGAATGAACTTTTTAAAGAGGCAAAGGAGCATGGAGCTATCCCTATCGATGACACCAGCAAATCCTCTGGAGCTTTTTATAGAGCAAGGACATTTACAGGTAGAGGTTACAAGCTTGGTGATTCATCAAAAAGGGAATTCGAATACATGCAGGGTGAAGATCCATTCGAACAAGGGCAAGAGATACAAATTTTGCTGAAACTCTGGAGCAATGGTTTCAGTTTAGATGATGGAGAACTGAGGTCTTACTCAGATCCAATAAATGCAGAGTTTCTGGAATCAGTCAAGAAAGGAGAGATTCCAGTAGAGCTCCAACGACTGGTGCATGGCGGTCAGGTGAACTGGGATATGGGAGACCCCCAGGACCAAGAATATATTAAGCCCAGGTTTAAATTAAAGCCATTTCGTGGGAGAGGGAAGGGGGCTTGGGAATTGT
Full Trace Sequence: CGGGGGCCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAGGAAAGAGAGAATTCCGAGGAAGGGGACGACGGTGCGGGCGAAGAAGAGGAGGAGGACCAAGGATCTGGCGAGGACGGAGGCGAGGTGGGGGCGGAGAGAGAGCAAGAGGCGGAACTAAAGGATTCGCTCAGGCCCTCAGTGCTGGACCTGCAGTTGGCACTGGCTCGACTGTGTGAGGATGAGTACCAAGATCAGCCATCAAAAATGCCTGTATTAGGGCTGCAAATTAAAGATCATCAATTTGAAAGATCTTTTTCAGGTAATGGCAAAGTCCCTTCTCCAGGCAAAATTGTGAATGAACTTTTTAAAGAGGCAAAGGAGCATGGAGCTATCCCTATCGATGACACCAGCAAATCCTCTGGAGCTTTTTATAGAGCAAGGACATTTACAGGTAGAGGTTACAAGCTTGGTGATTCATCAAAAAGGGAATTCGAATACATGCAGGGTGAAGATCCATTCGAACAAGGGCAAGAGATACAAATTTTGCTGAAACTCTGGAGCAATGGTTTCAGTTTAGATGATGGAGAACTGAGGTCTTACTCAGATCCAATAAATGCAGAGTTTCTGGAATCAGTCAAGAAAGGAGAGATTCCAGTAGAGCTCCAACGACTGGTGCATGGCGGTCAGGTGAACTGGGATATGGGAGACCCCCAGGACCAAGAATATATTAAGCCCAGGTTTAAATTAAAGCCATTTCGTGGGAGAGGGAAGGGGGCTTGGGAATTGT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAGGAAAGAGAGAATTCCGAG

Sequences - 3ʹ (reverse) EST

Accession: JZ838058
dbEST ID: 79655760
Trimmed Sequence: CTTTAGCCTTTGAAGAATCACAGTGTTGAGAATATCAGCTTCTTCCAATGTCTGGGTTTCATCTGTAAGTTCTACATTTGGAAATGTAGTCAACAAAGCAAAATCACATTGGGCAAAGTCTGATCGGGCATGGATAATAAACTGACGCACATCCATGATCCTGTGACTAAGGTTAAATCTTTGTATTAACCGAGTACCATCAGCTAGCCTAATCTGAATTTTGGTTGTTGGTACATGTTCATCGAGATCAACCTCTGCATTGAGAAATCTCTTGTGTTCCTCTTCAGGTGATGATGGGGTACTGATAATTTCAGGAGTAACACTTCCAAGTTTTTTTCCTTCTCCACTGAATGCTTTAAATTTTAACCTGGGCTTAATATATTCTTGGTCCTGGTGGTCTTCCATATCCAAGTTCACCTGACCGCCATGCACCAGTCGTTGGAGCTCTACTGGAATCTCTCCTTTCTTGACTGATTCCAGAAACTCTGCATTTATTGGATCTGAGTAAGACCTCAGTTCTCCATCATCTAAACTGAAACCATTGCTCCAGAGTTTCAGCAAAATTTGTATCTCTTGCCCTTGGTCGAATGGATCTTCAGCCTGCACGTATTCGAATTCCCTTTTTGATGAATCACCCAGCTTGTAACCTCTACCTGTAAATGGTCCTTGGTCCTTTAAAAGGCCCCCAAAAGAATTTGCTGGGGGTCCTCCGAGTAGGGAATAACTGCCGGGCCTCCCTTTGGCCTTCCTTTAAAAAATTTTCATTTCAA
Full Trace Sequence: GGGGAATATGCTATAGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTTTAGCCTTTGAAGAATCACAGTGTTGAGAATATCAGCTTCTTCCAATGTCTGGGTTTCATCTGTAAGTTCTACATTTGGAAATGTAGTCAACAAAGCAAAATCACATTGGGCAAAGTCTGATCGGGCATGGATAATAAACTGACGCACATCCATGATCCTGTGACTAAGGTTAAATCTTTGTATTAACCGAGTACCATCAGCTAGCCTAATCTGAATTTTGGTTGTTGGTACATGTTCATCGAGATCAACCTCTGCATTGAGAAATCTCTTGTGTTCCTCTTCAGGTGATGATGGGGTACTGATAATTTCAGGAGTAACACTTCCAAGTTTTTTTCCTTCTCCACTGAATGCTTTAAATTTTAACCTGGGCTTAATATATTCTTGGTCCTGGTGGTCTTCCATATCCAAGTTCACCTGACCGCCATGCACCAGTCGTTGGAGCTCTACTGGAATCTCTCCTTTCTTGACTGATTCCAGAAACTCTGCATTTATTGGATCTGAGTAAGACCTCAGTTCTCCATCATCTAAACTGAAACCATTGCTCCAGAGTTTCAGCAAAATTTGTATCTCTTGCCCTTGGTCGAATGGATCTTCAGCCTGCACGTATTCGAATTCCCTTTTTGATGAATCACCCAGCTTGTAACCTCTACCTGTAAATGGTCCTTGGTCCTTTAAAAGGCCCCCAAAAGAATTTGCTGGGGGTCCTCCGAGTAGGGAATAACTGCCGGGCCTCCCTTTGGCCTTCCTTTAAAAAATTTTCATTTCAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTTTAGCCTTTGAAGAATCACAG