ORFeome > ubxn8 ORF1 – XORFeome v1.0

ubxn8 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: ubxn8
Gene ID: 6254850
Gene Page ID: 946443
ORF Xenbase ID: 17303541

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC133751
Original XGC clone length: 813

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11089
Well Location: E04

Sequences - 5ʹ (forward) EST

Accession: JZ838467
dbEST ID: 79656169
Trimmed Sequence: ATGGCAGGAAGCCGGGCTCTGCTTGTTGGCTGTGCAGCTCTTTCTTGTATTAAAAGAATGGTCAAAAAGGGGAATTCCTGTAGGTTTGAATGAAGTTGTCATTTGGACTGGAAGATTTATCTTGTTACTTGCTTTTCTTACCATAATAATTTCACTTGTTTCTCCATGGATTACATCAGTTAATGTACAGAAGGACATTTGTACTGTGCCACAAGAAGAAAAAGAAAGGCAGCAAAAGCTTTTAAGGGAAAAGCAGCAAGAACAGTTGAGTAAACAGGTACATTCGCATGTTGAGAATGTTCTTAAGCCACGTGAAGAACTAAAGCTTCGAAAGAAAATAGAAACGCTTGGTAAATCACAACTATGGACATTATCTCAAGGCTGCAGGCTTGGTGAGGCTGAGGAGTCTGTGAACATATGCAGTGATTCAGACGACGGCACAGAGAGTGCAAATAATGAGGCTGTAAGAAAAAGAAAACTACCAGAACAAGTCACCAAGCCCTTGCCAAAGAATGAGCTCCCCAAACCTACGAAGGTAATTACTTTGCCAGAAGAAGCCGTTGAGGGGAGGGAATGGGGGTGAGTGACATCGCCCCCAAAATGTCGCAGCGGGCGTGTTGTTTAAAGGAAGATTTGTACACTGCTGCAGTTCCCCTTGTGGTTGTGGGAATGGAAGGAAAAAAAATAAAA
Full Trace Sequence: TCGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCAGGAAGCCGGGCTCTGCTTGTTGGCTGTGCAGCTCTTTCTTGTATTAAAAGAATGGTCAAAAAGGGGAATTCCTGTAGGTTTGAATGAAGTTGTCATTTGGACTGGAAGATTTATCTTGTTACTTGCTTTTCTTACCATAATAATTTCACTTGTTTCTCCATGGATTACATCAGTTAATGTACAGAAGGACATTTGTACTGTGCCACAAGAAGAAAAAGAAAGGCAGCAAAAGCTTTTAAGGGAAAAGCAGCAAGAACAGTTGAGTAAACAGGTACATTCGCATGTTGAGAATGTTCTTAAGCCACGTGAAGAACTAAAGCTTCGAAAGAAAATAGAAACGCTTGGTAAATCACAACTATGGACATTATCTCAAGGCTGCAGGCTTGGTGAGGCTGAGGAGTCTGTGAACATATGCAGTGATTCAGACGACGGCACAGAGAGTGCAAATAATGAGGCTGTAAGAAAAAGAAAACTACCAGAACAAGTCACCAAGCCCTTGCCAAAGAATGAGCTCCCCAAACCTACGAAGGTAATTACTTTGCCAGAAGAAGCCGTTGAGGGGAGGGAATGGGGGTGAGTGACATCGCCCCCAAAATGTCGCAGCGGGCGTGTTGTTTAAAGGAAGATTTGTACACTGCTGCAGTTCCCCTTGTGGTTGTGGGAATGGAAGGAAAAAAAATAAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCAGGAAGCCGGGCTC

Sequences - 3ʹ (reverse) EST

Accession: JZ838466
dbEST ID: 79656168
Trimmed Sequence: AGTAGTTTTTTCTTCCACATTCAAAACGATGTCCTTCAAAATCCCAATGTCCTCTAATGATGAACTACTCTTGAATTCTAACTGGCATCTTGGAAATGTAGAGCAGATGGTATAAATAACCGGATGGTAACCAAGTTTCATCATCCAGTCCAACAACACAAGTGAACTGCATGAAGTGTAAAACCTTCTTTTAAAAACACGCCCGCTGGGACATCTTAGGGCGATGGTAATTACCCCATTCCCTCCCTCAACGGGTTCTTCTGGCGAAGTAATTACCTTTGTAGGTTTGGGGAGCTCATTCTTTGGCAAGGGCTTGGTGACTTATTCTGGTAGTTTTCTTTTTCTTACAGCCGCATTATTTTCACTCTCTGTGCCGTCGTCTGAATCACAGCGTATGTTCACAGACTCCTCAGCCTCGCCAAACCTGCAGCGCTTAGAGAAAATCCGGAGTTGTGATGTGACAAACAGTTCTATTTTCTTTCTAAACTAGAGGTCTTTGCGGTGGGGAGAGGGAATATCACAAGGGAGGGGGGGGAGGGGGGTACATCGCCCCGCGGGCCGCTCCTTGGCCGTTGGGGGGGGAATGGGGGGGGGGGGGGGTTCTTTTCTTCGTCCGCGCGGGGGGGGGGAGGGGGGGGGGCGTCTAAATAAAGGAAAGGAGAAGGGAGAA
Full Trace Sequence: CGGGAAAAGGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAGTAGTTTTTTCTTCCACATTCAAAACGATGTCCTTCAAAATCCCAATGTCCTCTAATGATGAACTACTCTTGAATTCTAACTGGCATCTTGGAAATGTAGAGCAGATGGTATAAATAACCGGATGGTAACCAAGTTTCATCATCCAGTCCAACAACACAAGTGAACTGCATGAAGTGTAAAACCTTCTTTTAAAAACACGCCCGCTGGGACATCTTAGGGCGATGGTAATTACCCCATTCCCTCCCTCAACGGGTTCTTCTGGCGAAGTAATTACCTTTGTAGGTTTGGGGAGCTCATTCTTTGGCAAGGGCTTGGTGACTTATTCTGGTAGTTTTCTTTTTCTTACAGCCGCATTATTTTCACTCTCTGTGCCGTCGTCTGAATCACAGCGTATGTTCACAGACTCCTCAGCCTCGCCAAACCTGCAGCGCTTAGAGAAAATCCGGAGTTGTGATGTGACAAACAGTTCTATTTTCTTTCTAAACTAGAGGTCTTTGCGGTGGGGAGAGGGAATATCACAAGGGAGGGGGGGGAGGGGGGTACATCGCCCCGCGGGCCGCTCCTTGGCCGTTGGGGGGGGAATGGGGGGGGGGGGGGGTTCTTTTCTTCGTCCGCGCGGGGGGGGGGAGGGGGGGGGGCGTCTAAATAAAGGAAAGGAGAAGGGAGAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAGTAGTTTTTTCTTCCACATT