ORFeome > uchl1 ORF1 – XORFeome v1.0

uchl1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: uchl1
Gene ID: 1000437
Gene Page ID: 1000431
ORF Xenbase ID: 17303547

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC106642
Original XGC clone length: 672

Human orthology & disease relationships

NCBI Entrez ID: 7345
Ensembl gene IDs: ENSG00000154277
Directly associated (OMIM) disease MIM numbers: 613643,615491
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11085
Well Location: E10

Sequences - 5ʹ (forward) EST

Accession: JZ837746
dbEST ID: 79655448
Trimmed Sequence: ATGCAGTGGAGAGCGATGGAAATCAATCCTGAGATGCTGAACAAAGTTTTGTCCCAGTTGGGTGTGTCTGGTGCCTGGAAATTTGTGGATGTCTTGGGATTTGAGGATGAATCTCTGAACAATGTTCTCACACCAGTCTGTGCATTACTGCTACTTTTCCCTCTTACCCCACAGCATGAAAACTTTAGAAAGTGCCAAATAAAGGAGCTGCAAGAGAAGAATGCAAACAATAAAGTGTATTTCTTAAAACAGACCATTGGTAATTCCTGTGGTACAGTTGGGCTTATTCATGCTGTGGCTAATAATAAAGATAAATTTAATTTTGCTGAAAACTCAGTGTTAAAGGGTTTTATCGAACAAACTGCTGCGCTTTCACCTGAAGAAAGGGCAATACACCTAGAAAAAAATGAGGCTATAAAGTCTGCTCACAACTCTGTGGCTGCTGAAGGACAATGCAGGGAGAACAGTGATGTAAACTTTCATTTTATATTGTTCACTGCTGTTGATGGACATCTTTATGAGTTGGATGGCAGACTTCCTTCCCCTGTGGAAAATGATCCAACCTCTGAAGGCACTTTTACTATGGATGCAGGCGAAATATGCAAACAGTTTTACTGAGCGTGAACAAGGAAAAAGTTCGTTTTCTGCTGTGGCTCCTAGCAAATCTGCTTTTTCCCAATTTTTCTTGTAAAAAGTTGGGCATTATAAAAAAACAATTGCTTAATCAATTTGTT
Full Trace Sequence: CGCGGCCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCAGTGGAGAGCGATGGAAATCAATCCTGAGATGCTGAACAAAGTTTTGTCCCAGTTGGGTGTGTCTGGTGCCTGGAAATTTGTGGATGTCTTGGGATTTGAGGATGAATCTCTGAACAATGTTCTCACACCAGTCTGTGCATTACTGCTACTTTTCCCTCTTACCCCACAGCATGAAAACTTTAGAAAGTGCCAAATAAAGGAGCTGCAAGAGAAGAATGCAAACAATAAAGTGTATTTCTTAAAACAGACCATTGGTAATTCCTGTGGTACAGTTGGGCTTATTCATGCTGTGGCTAATAATAAAGATAAATTTAATTTTGCTGAAAACTCAGTGTTAAAGGGTTTTATCGAACAAACTGCTGCGCTTTCACCTGAAGAAAGGGCAATACACCTAGAAAAAAATGAGGCTATAAAGTCTGCTCACAACTCTGTGGCTGCTGAAGGACAATGCAGGGAGAACAGTGATGTAAACTTTCATTTTATATTGTTCACTGCTGTTGATGGACATCTTTATGAGTTGGATGGCAGACTTCCTTCCCCTGTGGAAAATGATCCAACCTCTGAAGGCACTTTTACTATGGATGCAGGCGAAATATGCAAACAGTTTTACTGAGCGTGAACAAGGAAAAAGTTCGTTTTCTGCTGTGGCTCCTAGCAAATCTGCTTTTTCCCAATTTTTCTTGTAAAAAGTTGGGCATTATAAAAAAACAATTGCTTAATCAATTTGTT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCAGTGGAGAGCGATGGA

Sequences - 3ʹ (reverse) EST

Accession: JZ837745
dbEST ID: 79655447
Trimmed Sequence: AGCAGATTTGCTTAGAGCCACAGCAGAAAAACGAACTTCTCCTTGTTCACGCTCAGTAAACTGTCTGCATATTTTGGCTGCATCCTTTAGTAAAGTGCCTTCAGAGGTTGGATCATGTTCCACAGGGGAAGGAAGTCTGCCATCCAACTCATAAAGATGTCCATCAACAGCAGTGAACAATATAAAATGAAAGTTTACATCACTGTTCTCCCTGCATTGTCCTTCAGCAGCCACAGAGTTGTGAGCAGACTTTATAGCCTCATTTTTTTCTAGGTGTATTGCCCTTTCTTCAGGTGAAAGCGCAGCAGTTTGTTCGATAAAACCCTTTAACACTGAGTTTTCAGCAAAATTAAATTTATCTTTATTATTAGCCACAGCATGAATAAGCCCAACTGTACCACAGGAATTACCAATGGTCTGTTTTAAGAAATACACTTTATTGTTTGCATTCTTCTCTTGCAGCTCCTTTATTTGGCACTTTCTAAAGTTTTCATGCTGTGGGGTAAGAGGGAAAAGTAGCAGTAATGCACAGACTGGTGTGAGAACATTGTTCAGAGATTCATCCTCATATCCCAAGACATCCACAAATTTCCAGGCGGGAGACACACCCGAGTGGGAGGAAGCTTTGTTCGGGGGCTCAGGAGGGATGGCCTCGCTCTCCACTGCGGGGGGGCGACTTTTTTTTACGAAGTTGGCGTGTAGAAAAAGCATTGGCTATCCGATTGTTGCAACCAAGAGGTCAGGTATAGTCCAAATAAAATCAAGAAAAAAAGAAGGAGCTAAAAATGCGGCGTCGGTGTAAACGACCGGAAACGGAAAACGGGGTGCGCTATTGCGAGGAACGGGGGTTGCGGGTTGAAGGGACGGGGGGGGGGGGGGGGGGGGCGGAGGGGGGGGGGCGGGGGGGGGGGAAGGGGAGGAGGGGAAGAGGGAGGAGGCGAAGGGCAAGACCGAGGGGGGACAGGGAGCGGGGAGAAGAAGGGGGGGGGGGGGGAGGCAGAGGGGGAGAAAAAAAGAAAAAAAAAAAAAAAAAAAAATAAAAAAAAGAAAGAATAAGAGGGAGGGGGAGGAGGAGAGGAGGAGGGAGNGGAGAGGGGGAAGAGGGGAAAAGGGAAAAGAAAAAAGAAAGGAGAAGA
Full Trace Sequence: GGCAGGGAAACAGCCACTGAACATGGTAAAACGACTCACTAGACGGGGAGAACAGCCAGGAGGGCAAAAATGATTATATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAGCAGATTTGCTTAGAGCCACAGCAGAAAAACGAACTTCTCCTTGTTCACGCTCAGTAAACTGTCTGCATATTTTGGCTGCATCCTTTAGTAAAGTGCCTTCAGAGGTTGGATCATGTTCCACAGGGGAAGGAAGTCTGCCATCCAACTCATAAAGATGTCCATCAACAGCAGTGAACAATATAAAATGAAAGTTTACATCACTGTTCTCCCTGCATTGTCCTTCAGCAGCCACAGAGTTGTGAGCAGACTTTATAGCCTCATTTTTTTCTAGGTGTATTGCCCTTTCTTCAGGTGAAAGCGCAGCAGTTTGTTCGATAAAACCCTTTAACACTGAGTTTTCAGCAAAATTAAATTTATCTTTATTATTAGCCACAGCATGAATAAGCCCAACTGTACCACAGGAATTACCAATGGTCTGTTTTAAGAAATACACTTTATTGTTTGCATTCTTCTCTTGCAGCTCCTTTATTTGGCACTTTCTAAAGTTTTCATGCTGTGGGGTAAGAGGGAAAAGTAGCAGTAATGCACAGACTGGTGTGAGAACATTGTTCAGAGATTCATCCTCATATCCCAAGACATCCACAAATTTCCAGGCGGGAGACACACCCGAGTGGGAGGAAGCTTTGTTCGGGGGCTCAGGAGGGATGGCCTCGCTCTCCACTGCGGGGGGGCGACTTTTTTTTACGAAGTTGGCGTGTAGAAAAAGCATTGGCTATCCGATTGTTGCAACCAAGAGGTCAGGTATAGTCCAAATAAAATCAAGAAAAAAAGAAGGAGCTAAAAATGCGGCGTCGGTGTAAACGACCGGAAACGGAAAACGGGGTGCGCTATTGCGAGGAACGGGGGTTGCGGGTTGAAGGGACGGGGGGGGGGGGGGGGGGGGCGGAGGGGGGGGGGCGGGGGGGGGGGAAGGGGAGGAGGGGAAGAGGGAGGAGGCGAAGGGCAAGACCGAGGGGGGACAGGGAGCGGGGAGAAGAAGGGGGGGGGGGGGGAGGCAGAGGGGGAGAAAAAAAGAAAAAAAAAAAAAAAAAAAAATAAAAAAAAGAAAGAATAAGAGGGAGGGGGAGGAGGAGAGGAGGAGGGAGNGGAGAGGGGGAAGAGGGGAAAAGGGAAAAGAAAAAAGAAAGGAGAAGA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAGCAGATTTGCTTAGAGCC