ORFeome > ugp2 ORF1 – XORFeome v1.0

ugp2 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: ugp2
Gene ID: 974412
Gene Page ID: 974406
ORF Xenbase ID: 17303631

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC078581
Original XGC clone length: 264

Human orthology & disease relationships

NCBI Entrez ID: 7360
Ensembl gene IDs: ENSG00000169764
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 125853,128230,208000,223000,230200,230350,232600,233910,240600,260920,261750,300559,600121,602475,604232,607091,607748,607765

Library Location

Plate ID: GDExl11004
Well Location: H08

Sequences - 5ʹ (forward) EST

Accession: JZ839671
dbEST ID: 79657373
Trimmed Sequence: ATGACTTCCTATCCGGGAGGTATAAGGAACGCAATGGCAAGTGGTGGCATGTCCCACTTCCAGGAGGCCATCCGAGAGGAGTTGGAAGGAGCCATGAAGGCAGACTTGGAAAGAATTCTCTCCACAGCCCCAGAATCCGAATTAGAGCACACAAAGAAAGACCTTGCTGGGTTTCAGAAGTTGTTCCACAGATTTCTACAGGAAAAAGGTCCAGCAGTGGACTGGGGAAAGATCCAGAGACCTCCAGAGGATTCTGTAAGTTT
Full Trace Sequence: GCTCGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGACTTCCTATCCGGGAGGTATAAGGAACGCAATGGCAAGTGGTGGCATGTCCCACTTCCAGGAGGCCATCCGAGAGGAGTTGGAAGGAGCCATGAAGGCAGACTTGGAAAGAATTCTCTCCACAGCCCCAGAATCCGAATTAGAGCACACAAAGAAAGACCTTGCTGGGTTTCAGAAGTTGTTCCACAGATTTCTACAGGAAAAAGGTCCAGCAGTGGACTGGGGAAAGATCCAGAGACCTCCAGAGGATTCTGTAAGTTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCCCAAGAAAAAAAATCCAAAATGTTACATGGCCCCTTGGGACCGCAAAAGAAAAAAAAATAAAATGTTCTCCCCCGCCAGGGGGCCGGGCGCCTCACCGGTGAAAAGCGGTAAAGGCCCCCCCCAAGCGAAAAAATCCCCGGGAGAGCCATATCGTGGGGGAAAAAAAGAGCGCGCCCGCCCACGGGGAACAAACCTCTGGGCACCGCTCGGAGGGAAGGCGGGGGGGGGGTTTTTGGGGTTTTTAACATTTTTGTCTCTAAAAACTTCTCCCCGCGACGCCCCCCGGGGCACGCCCGGCCCCGGGGGGGGGTTTTTTTTGGGGTTTTTTATAAATTATTTTTTTGGGGGGGGGCCCCCCCCCCTCAACGCCTCCGGAGAAAAAAAAGGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGACTTCCTATCCGGGAGGTA

Sequences - 3ʹ (reverse) EST

Accession: JZ839670
dbEST ID: 79657372
Trimmed Sequence: ACTTACAGAATCCTCTGGAGGTCTCTGGATCTTTCCCCAGTCCACTGCTGGACCTTTTTCCTGTAGAAATCTGTGGAACAACTTCTGAAACCCAGCAAGGTCTTTCTTTGTGTGCTCTAATTCGGATTCTGGGGCTGTGGAGAGAATTCTTTCCAAGTCTGCCTTCATGGCTCCTTCCAACTCCTCTCGGATGGCCTCCTGGAAGTGGGACATGCCACCACTTGCCATTGCGTTCCTTATACCTCCCGGATAGGAAGTCATGG
Full Trace Sequence: GGGAAACGGCTTATGACCATGTAATACGACTCACTATAGGGGGAAATCAGNCTGGATGGCAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAACTTACAGAATCCTCTGGAGGTCTCTGGATCTTTCCCCAGTCCACTGCTGGACCTTTTTCCTGTAGAAATCTGTGGAACAACTTCTGAAACCCAGCAAGGTCTTTCTTTGTGTGCTCTAATTCGGATTCTGGGGCTGTGGAGAGAATTCTTTCCAAGTCTGCCTTCATGGCTCCTTCCAACTCCTCTCGGATGGCCTCCTGGAAGTGGGACATGCCACCACTTGCCATTGCGTTCCTTATACCTCCCGGATAGGAAGTCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGCCCGAGCTTAATACAGAGGAACGTTTTACAACATACATTACTGGCGTACTCGGGAACCGCCGGGATAAAAGAAACGAACGCTCTGTTCCGAAACGTGGGCGGGGGAGTTACCCGGTGGTAGCGAAGGAAGGAACACCCCAATGAAAAAAACCCCGGGCGGGTGGATTGCAGGGGTGGGGAGAGGGGGGGCGCAGGGCGCCCTGGCAAAAAAACTTAACACAAGCCCGGGGGGGGTAAGTGTCCAGGGGGGGGTTTTCACGCGTTGTTTTCAGATTGTTTTTTTAGGGTTTACTTCATACCCCCGCGGGGCACCCCCCCCCACCCCCGTTCTCCCCCGGGTGGGACGGTTTTTGGTTTGTTGAAAGAACGA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAACTTACAGAATCCTCTGGAGGT