ORFeome > uhrf2 ORF1 – XORFeome v1.0

uhrf2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: uhrf2
Gene ID: 6054048
Gene Page ID: 6054033
ORF Xenbase ID: 17303649

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC128673
Original XGC clone length: 2538

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11088
Well Location: B05

Sequences - 5ʹ (forward) EST

Accession: JZ838142
dbEST ID: 79655844
Trimmed Sequence: ATGTGGATCCAGGTCCGAACCATAGATGGCACAGAGACCCACACCATAGACGACTTGTCGCGTCTGACCAAGATCGAGAGCCTGAGGCTGAAGATTCAGGAGACCTTCAACGTCACACCAGACCGGCAAAGGCTCTTCTACCGGGGCAAACAGCTAGAAGATGGCCATACCCTTTTTGACTACGATGTTGGCTTGAATGACATTGTCCAGCTATTAATTCGCTCACAGTCAGATGATTCTTCTTCTTCCCTAAAGAAAAAAGATGGGGATGGGAGGGCTCACAGTAATGCTGCGAACAAGTCCAGAGTCAGTGCAACTTCCACTCTGCCATCAACATCTTCTATAGCATTCCTCATTGATCCAGGCATTGGAATTTACGAGATTAACGAGTTGGTCGATGCCCGTCATGTCAGTATAGGATCCTGGTTTGAATCGCCTGTGGAGAATGTCACCCACAATAAATAAGCACACAAGACTGGCTTGGCTTACTTGTATGGTGGCCTTTGTTACTGAATGGCTAATGGCAACTTGTACCACTTTCTAGACAATGTTGTGTATTCTAAACCTCCATATTCTTTCATTTCGTTTTGCGATGACAGTGACTATGTTACTTATCATATCCATTATTTTGATTAGGACTAATATCCCCCTATTTTAATTGGTTTTCGCCGGACTGGCCTCCTAACAGGGACGTGTGGAAGACTGGAAAGCGGTAGATGTT
Full Trace Sequence: TCGGGGCCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTGGATCCAGGTCCGAACCATAGATGGCACAGAGACCCACACCATAGACGACTTGTCGCGTCTGACCAAGATCGAGAGCCTGAGGCTGAAGATTCAGGAGACCTTCAACGTCACACCAGACCGGCAAAGGCTCTTCTACCGGGGCAAACAGCTAGAAGATGGCCATACCCTTTTTGACTACGATGTTGGCTTGAATGACATTGTCCAGCTATTAATTCGCTCACAGTCAGATGATTCTTCTTCTTCCCTAAAGAAAAAAGATGGGGATGGGAGGGCTCACAGTAATGCTGCGAACAAGTCCAGAGTCAGTGCAACTTCCACTCTGCCATCAACATCTTCTATAGCATTCCTCATTGATCCAGGCATTGGAATTTACGAGATTAACGAGTTGGTCGATGCCCGTCATGTCAGTATAGGATCCTGGTTTGAATCGCCTGTGGAGAATGTCACCCACAATAAATAAGCACACAAGACTGGCTTGGCTTACTTGTATGGTGGCCTTTGTTACTGAATGGCTAATGGCAACTTGTACCACTTTCTAGACAATGTTGTGTATTCTAAACCTCCATATTCTTTCATTTCGTTTTGCGATGACAGTGACTATGTTACTTATCATATCCATTATTTTGATTAGGACTAATATCCCCCTATTTTAATTGGTTTTCGCCGGACTGGCCTCCTAACAGGGACGTGTGGAAGACTGGAAAGCGGTAGATGTT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTGGATCCAGGTCCGAA

Sequences - 3ʹ (reverse) EST

Accession: JZ838141
dbEST ID: 79655843
Trimmed Sequence: CCGGCCTTTGCTATATCCAGGGAAAAACTGATCAAGAAGCGTTTGTAAAATTTTGTTGGCGACCATGTTGTATGACTTGCCTAGATCATAACGACAAGCAGGACAAGTGTAAACCTCTGCTCGGAAAGAACGTTGCAGGCAGCTTTTGCACACATTATGGAGGCAAGCAGTTGTTACAGGTTGGTATACAAGCTCCTGGCAGCAGACACACATGAAAGACTGTTCGACTTTCTTGAGAAATTTAGGTCCTTCCTTGATGGACACAAGCACTTCGTCCCATAGTTTCTGATTCAGTGTGTCCTCTCCTATTAACCACTGCTGTTGTTGAGTGAGCTGGAATGCCTCTCCTTTTGAATCTTCTGACAGTTTCATAGACTTGATAGGGGGCTTAATCTCTTTGTCCTCATCTTCCACTGCTCTTTTCTGGTTCCCATTGCTTTGGCTGCTGCTGAACTTCTGACTCTCTCATCTGACTGGACTAGTGGCTTGCTCTGGGCTGCTTGGCGGCTGCTGGTTAGGTGTGTTGCTGGTGTTCTGAAGAATTCTGATTGACTGGGCAGCAGGTTTACGGACTTACGAGCTGCCTTTTCCACTAACCCTCCCCCTCTGTGCCAACCATAACTTCAAAATACCCCCAAGGAAAAGAAAATGCAGGACATAGGGTTTAGAGCACAAACGCATGCCCAAAGGAAATCAAAGGAAACAGGCCCCTCGGGTCTCCAACTCCTGAAGGAGGG
Full Trace Sequence: GAAAACGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACCGGCCTTTGCTATATCCAGGGAAAAACTGATCAAGAAGCGTTTGTAAAATTTTGTTGGCGACCATGTTGTATGACTTGCCTAGATCATAACGACAAGCAGGACAAGTGTAAACCTCTGCTCGGAAAGAACGTTGCAGGCAGCTTTTGCACACATTATGGAGGCAAGCAGTTGTTACAGGTTGGTATACAAGCTCCTGGCAGCAGACACACATGAAAGACTGTTCGACTTTCTTGAGAAATTTAGGTCCTTCCTTGATGGACACAAGCACTTCGTCCCATAGTTTCTGATTCAGTGTGTCCTCTCCTATTAACCACTGCTGTTGTTGAGTGAGCTGGAATGCCTCTCCTTTTGAATCTTCTGACAGTTTCATAGACTTGATAGGGGGCTTAATCTCTTTGTCCTCATCTTCCACTGCTCTTTTCTGGTTCCCATTGCTTTGGCTGCTGCTGAACTTCTGACTCTCTCATCTGACTGGACTAGTGGCTTGCTCTGGGCTGCTTGGCGGCTGCTGGTTAGGTGTGTTGCTGGTGTTCTGAAGAATTCTGATTGACTGGGCAGCAGGTTTACGGACTTACGAGCTGCCTTTTCCACTAACCCTCCCCCTCTGTGCCAACCATAACTTCAAAATACCCCCAAGGAAAAGAAAATGCAGGACATAGGGTTTAGAGCACAAACGCATGCCCAAAGGAAATCAAAGGAAACAGGCCCCTCGGGTCTCCAACTCCTGAAGGAGGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACCGGCCTTTGCTATATCCAGGGAA