ORFeome > uqcc ORF1 – XORFeome v1.0

uqcc ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: uqcc
Gene ID: 6251942
Gene Page ID: 1017092
ORF Xenbase ID: 17303739

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123155
Original XGC clone length: 903

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11088
Well Location: H01

Sequences - 5ʹ (forward) EST

Accession: JZ838174
dbEST ID: 79655876
Trimmed Sequence: ATGGCAGCGCTCATCAGATTAGGAATGCGAATAAACACGCAGATAGCAGCTTGCAGTGCATTACCCCAGAGCACCTTTGTGCCCATCCATTGTGTGGCAGCACGGTACAGCACTGGCCAGCATCTGAGTCATGCTAAGGGTGAGCTGAGAGAAATACTCAGTGGACCTGTACACAGAACCCCTGCCGTGACATCACAAATATGGAGACCTCTGCATGTTACTCACATGAACCAGACAACAAAAGACAAGCTTCAGCCATCAGAGGAAGAGGTTTCAACTTTTACTAAAATAATTGAAGCAATGGGTTTCACCGGACCTCTGAAGTACAACAAATGGAAAATCAAAATTGCTGCCCTGCGCATGTATACTTGCTGCGTGGAAAGAATAGATTATGATGAATTTTTTGAAAAATGCAGTCTCCCTGATACATTAAACTCCTGGTTCCTTGTAATTCAACTTCATGTCTGGATGTGCTTGGTCCGGATGAAACAGGAAGGCCGTGCTGGAAAGTATATGTGTAGATACATCGTCCATTCCATGTGGGAAGATGTTGAACAGCGTGGGAAAGTCATGGGGATTGATTCCGTGACCCTGAAAAACAGTATGAGATCTATGACTGAGATTTTCTATGCTGCAATATTTGGCTATAATGAGGGAATTATATCTGATGACCAAATTCTGGCTGCTGCCCTGTGGAGAAACGTTTTAACAAACAATGTAATGACCCCCGAAACCTGGAACTAATGGGTGAAATATTTGACGGAAACCGGTTCCAGTTC
Full Trace Sequence: CGGGGGCCCAAATAATAGATTTTATTTTNGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCAGCGCTCATCAGATTAGGAATGCGAATAAACACGCAGATAGCAGCTTGCAGTGCATTACCCCAGAGCACCTTTGTGCCCATCCATTGTGTGGCAGCACGGTACAGCACTGGCCAGCATCTGAGTCATGCTAAGGGTGAGCTGAGAGAAATACTCAGTGGACCTGTACACAGAACCCCTGCCGTGACATCACAAATATGGAGACCTCTGCATGTTACTCACATGAACCAGACAACAAAAGACAAGCTTCAGCCATCAGAGGAAGAGGTTTCAACTTTTACTAAAATAATTGAAGCAATGGGTTTCACCGGACCTCTGAAGTACAACAAATGGAAAATCAAAATTGCTGCCCTGCGCATGTATACTTGCTGCGTGGAAAGAATAGATTATGATGAATTTTTTGAAAAATGCAGTCTCCCTGATACATTAAACTCCTGGTTCCTTGTAATTCAACTTCATGTCTGGATGTGCTTGGTCCGGATGAAACAGGAAGGCCGTGCTGGAAAGTATATGTGTAGATACATCGTCCATTCCATGTGGGAAGATGTTGAACAGCGTGGGAAAGTCATGGGGATTGATTCCGTGACCCTGAAAAACAGTATGAGATCTATGACTGAGATTTTCTATGCTGCAATATTTGGCTATAATGAGGGAATTATATCTGATGACCAAATTCTGGCTGCTGCCCTGTGGAGAAACGTTTTAACAAACAATGTAATGACCCCCGAAACCTGGAACTAATGGGTGAAATATTTGACGGAAACCGGTTCCAGTTC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCAGCGCTCATCAGATT

Sequences - 3ʹ (reverse) EST

Accession: JZ838173
dbEST ID: 79655875
Trimmed Sequence: AAGTCCTTCATCGTTATACGTCGGTGTTGACGGTTTCAGAATGCTCTGAGCATCTTTTTCCACCAGAGGGCGCCAGACCACTTCACCAGTCAACAGAAGGTCTTCTCCATCGAGAGTATCCAGGAACTGCACCTGTTTCCGTACATATTCCACCAATAGTTCCAGCTTTCGGGGGTCATCACATTGTTTGTTTAAAAGGTTCCTCCACAGGGCAGCAGCCAGAATTCGGTCATCAGATATAATTCCCTCATCATAGCCAAATATTGCAGCATAGAAAATCTCAGTCATAGATCTCATACTGTTCTTCAGGGTCACGGAATCAATCCCCATGACTTTCCCACGCTGTTCAACATCTTCCCACATGGAATGGACGATGTATCTACACATATACTTTCCAGCACGGCCTTCCTGTTTCATCCGGACCAAGCACATCCCGACATGAAGTTGAATTACAAGGAACCAGGAGTTTAATGTATCAGGGAGACTGCATTTTTCATAAAATTCATCATAATCTATTCTTTCCACGCAGCGGGTATACATGCGCAGGGGCGCAATTTTGATTTTCCATTTGTTGTACTTCAGAGGTCCGGTGAACCCCATTGCTTCAATTATTTTATTAAAAATTGAAACCTCCTCCTCTTATTGCTGAAGCGTGTCTTTTGTTGTCTGTTTCAGGTTAGGTAAAGGGCAAAAAGTTCTCCAATATTTGTTATTTACCCGGGCGGGGGGGTTTCGGTGTGGAAGGGTTCCGGCGGGGGTTT
Full Trace Sequence: GGAAAAAGTCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAAGTCCTTCATCGTTATACGTCGGTGTTGACGGTTTCAGAATGCTCTGAGCATCTTTTTCCACCAGAGGGCGCCAGACCACTTCACCAGTCAACAGAAGGTCTTCTCCATCGAGAGTATCCAGGAACTGCACCTGTTTCCGTACATATTCCACCAATAGTTCCAGCTTTCGGGGGTCATCACATTGTTTGTTTAAAAGGTTCCTCCACAGGGCAGCAGCCAGAATTCGGTCATCAGATATAATTCCCTCATCATAGCCAAATATTGCAGCATAGAAAATCTCAGTCATAGATCTCATACTGTTCTTCAGGGTCACGGAATCAATCCCCATGACTTTCCCACGCTGTTCAACATCTTCCCACATGGAATGGACGATGTATCTACACATATACTTTCCAGCACGGCCTTCCTGTTTCATCCGGACCAAGCACATCCCGACATGAAGTTGAATTACAAGGAACCAGGAGTTTAATGTATCAGGGAGACTGCATTTTTCATAAAATTCATCATAATCTATTCTTTCCACGCAGCGGGTATACATGCGCAGGGGCGCAATTTTGATTTTCCATTTGTTGTACTTCAGAGGTCCGGTGAACCCCATTGCTTCAATTATTTTATTAAAAATTGAAACCTCCTCCTCTTATTGCTGAAGCGTGTCTTTTGTTGTCTGTTTCAGGTTAGGTAAAGGGCAAAAAGTTCTCCAATATTTGTTATTTACCCGGGCGGGGGGGTTTCGGTGTGGAAGGGTTCCGGCGGGGGTTT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAAGTCCTTCATCGTTATACGTC