ORFeome > uqcrb ORF1 – XORFeome v1.0

uqcrb ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: uqcrb
Gene ID: 6254556
Gene Page ID: 6457635
ORF Xenbase ID: 17303745

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC078487
Original XGC clone length: 336

Human orthology & disease relationships

NCBI Entrez ID: 7381
Ensembl gene IDs: ENSG00000156467
Directly associated (OMIM) disease MIM numbers: 615158
Indirectly associated (Lage, et al.) disease MIM numbers: 500000,535000

Library Location

Plate ID: GDExl11004
Well Location: F03

Sequences - 5ʹ (forward) EST

Accession: JZ839726
dbEST ID: 79657428
Trimmed Sequence: ATGGCAGCTCGGGCACCAGTTGCTGCATCAGGCCGCCTCTTAGATGGTTTGCGGAAATGGTATTATAATATTGCTGGATTCAACAAACTCGGTTTAATGAGAGATGACACCATTTATGAAGATGATGACGTGAAAGAGGCAATACGGAGGCTGCCACCTAGAGTTTATGATGACAGACTTTTTCGTATCAAGAGGGCTCTGGACGTTAGCCTCAGACAGCAGCACCTCCCAAAACAACAATGGACTAAATATGAAGAGGATGTTCGTTATCTGGAACCATATCTGAAAGAAGTGATCCGTGAAAGAAAAGAAAAAGAAGAATGGCAAAAGAAATT
Full Trace Sequence: GGGTTTCTAGCTCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCAGCTCGGGCACCAGTTGCTGCATCAGGCCGCCTCTTAGATGGTTTGCGGAAATGGTATTATAATATTGCTGGATTCAACAAACTCGGTTTAATGAGAGATGACACCATTTATGAAGATGATGACGTGAAAGAGGCAATACGGAGGCTGCCACCTAGAGTTTATGATGACAGACTTTTTCGTATCAAGAGGGCTCTGGACGTTAGCCTCAGACAGCAGCACCTCCCAAAACAACAATGGACTAAATATGAAGAGGATGTTCGTTATCTGGAACCATATCTGAAAGAAGTGATCCGTGAAAGAAAAGAAAAAGAAGAATGGCAAAAGAAATTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCCCGTGTCAAAAAATAAAAGATGATACGAAAAAAATTTTTTGTTGTGGGGGGCGGGAGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGGGGCGCTTCTTCAATAATTGTGGGGAAAAAAAGCCCCCACCAACTCGCAACCCCCACCGGGGCGGGGGGGGGGTAAATTAAGGTGGGGGAGGAGGGGCGGGAGAGGGGCGCACACCCCCCGAGGAAAAGAACGGCGGGGGGGAGGAGGGAGAATAAGGGTGGGTGTGGTGATTATTTTTTTTGGTTTTCTTCCCCTCCCCCTCTATTTTCCCCCAACACAAAACATACAACCACAC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCAGCTCGGGCACCAGTT

Sequences - 3ʹ (reverse) EST

Accession: JZ839725
dbEST ID: 79657427
Trimmed Sequence: TTTCTTTTGCCATTCTTCTTTTTCTTTTCTTTCACGGATCACTTCTTTCAGATATGGTTCCAGATAACGAACATCCTCTTCATATTTAGTCCATTGTTGTTTTGGGAGGTGCTGCTGTCTGAGGCTAACGTCCAGAGCCCTCTTGATACGAAAAAGTCTGTCATCATAAACTCTAGGTGGCAGCCTCCGTATTGCCTCTTTCACGTCATCATCTTCATAAATGGTGTCATCTCTCATTAAACCGAGTTTGTTGAATCCAGCAATATTATAATACCATTTCCGCAAACCATCTAAGAGGCGGCCTGATGCATCAACTGGTGCCCGAGCTGCCATGG
Full Trace Sequence: AAAACGGCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTTCTTTTGCCATTCTTCTTTTTCTTTTCTTTCACGGATCACTTCTTTCAGATATGGTTCCAGATAACGAACATCCTCTTCATATTTAGTCCATTGTTGTTTTGGGAGGTGCTGCTGTCTGAGGCTAACGTCCAGAGCCCTCTTGATACGAAAAAGTCTGTCATCATAAACTCTAGGTGGCAGCCTCCGTATTGCCTCTTTCACGTCATCATCTTCATAAATGGTGTCATCTCTCATTAAACCGAGTTTGTTGAATCCAGCAATATTATAATACCATTTCCGCAAACCATCTAAGAGGCGGCCTGATGCATCAACTGGTGCCCGAGCTGCCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGCCCGAGCTTAATACTGGCCGTCAAAATAAAACAAAAAAAACAAGGATATTACATCTCCTCTCTCCCCGCGGAAAAAAAAAAAAAACAACAGACTCATCTAAACCAGGGGGGTGTGGTTGCCTTTTGTTAGAGGAAAAAAAAAAACAAAGCCACACAACAAAGAACGCGGTGTGGCGTTTTTATTTTAGTATGGGAGCGGGGAGGCGGAGGCCCCCCCCCACACAAAAAAAACCAACCCCGGCGGGCGGAGGGGGTGTGTTGGGTGGGTTGGGGGGGAGTTGTCGCTCTCTAGGGTTTGTTGTTTTTTTTATNTTTTTCCACACCAAACAAACCCCGCGCCGGCCG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTTCTTTTGCCATTCTTCTTT