ORFeome > uqcrq ORF1 – XORFeome v1.0

uqcrq ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: uqcrq
Gene ID: 6254704
Gene Page ID: 977451
ORF Xenbase ID: 17303775

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC133228
Original XGC clone length: 249

Human orthology & disease relationships

NCBI Entrez ID: 27089
Ensembl gene IDs: ENSG00000164405
Directly associated (OMIM) disease MIM numbers: 615159
Indirectly associated (Lage, et al.) disease MIM numbers: 214150,216400,601675

Library Location

Plate ID: GDExl11006
Well Location: B11

Sequences - 5ʹ (forward) EST

Accession: JZ840198
dbEST ID: 79657900
Trimmed Sequence: ATGGGCCGTCACTTCGGAGACCTTGCCAAGGTCCGACATATCATCAGCTACAGCCTGTCTCCCTTCGAGCAGCGTGCTTTCCCCCACTTCTTCTCTAAAGGGATCCCCAATGTTTGGAGAAGATTCCGGGCTAAGGTCTTTCAAGTAGTGCCACCTTTTGTGCTCTCATACGTCGTCTACACATGGGGGACACAAGTGCACGCAGACCTCAAAAAGAAGGACCCATCCTTGTATGAAAAAGACCAGTT
Full Trace Sequence: GGGGGCTTCATGCTCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGGCCGTCACTTCGGAGACCTTGCCAAGGTCCGACATATCATCAGCTACAGCCTGTCTCCCTTCGAGCAGCGTGCTTTCCCCCACTTCTTCTCTAAAGGGATCCCCAATGTTTGGAGAAGATTCCGGGCTAAGGTCTTTCAAGTAGTGCCACCTTTTGTGCTCTCATACGTCGTCTACACATGGGGGACACAAGTGCACGCAGACCTCAAAAAGAAGGACCCATCCTTGTATGAAAAAGACCAGTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCCCGAAAAAAAAAATCTCAAATGTTACATTAAAGATCCCTGACCATAGCAGGGAAAAAAAAAAAAAAGTCCCCGCCCACCCAGGGCGCCCGGGGGAAAAAATTGGTTAACAGGGAGAGGCCAACAAGGGTGGCAAGAGGAAGGAAAACGTGTGAAAAGGGATAAAAGACACGAACCCGGGGGGGAACCTGGCCCGGATCAGGTTCAAAAAACTGGTAGGGGAAAAAGGCGGGGGGGGCCCCACCGGGGTTGGGTTCAAAAATTTTTGGGAGAAAACCGCGGGGGGGGGAACGGCCCACCGGGGGGGGTTTTCTCGGGGGTGTGTGTATTGTGGGGTTGTGTTTTGGGGGGGAAAACACCCCTCCCCCCCCCCGGGCCCCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGCCGTCACTTCGGA

Sequences - 3ʹ (reverse) EST

Accession: JZ840197
dbEST ID: 79657899
Trimmed Sequence: CTGGTCTTTTTCATACAAGGATGGGTCCTTCTTTTTGAGGTCTGCGTGCACTTGTGTCCCCCATGTGTAGACGACGTATGAGAGCACAAAAGGTGGCACTACTTGAAAGACCTTAGCCCGGAATCTTCTCCAAACATTGGGGATCCCTTTATAGAAGAAGTGGGGGAAAGCACGCTGCTCGAAGGGAGACAGGCTGTAGCTGATGATATGTCGGACCTTGGCAAGGTCTCCGAAGTGACGGCCCATGG
Full Trace Sequence: GCGTGCATCAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAAAAAGTTGGCAACTGGTCTTTTTCATACAAGGATGGGTCCTTCTTTTTGAGGTCTGCGTGCACTTGTGTCCCCCATGTGTAGACGACGTATGAGAGCACAAAAGGTGGCACTACTTGAAAGACCTTAGCCCGGAATCTTCTCCAAACATTGGGGATCCCTTTATAGAAGAAGTGGGGGAAAGCACGCTGCTCGAAGGGAGACAGGCTGTAGCTGATGATATGTCGGACCTTGGCAAGGTCTCCGAAGTGACGGCCCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCGGTCCGACTTTAATACCGTAAAAAAATATACAAATATTAGCATGGCAGTTTCCTGACAGCAACAACCCATATCGAACAATCTCACCGGTCAAACAGGGGGCCGGGGGGGTCTCCTTGTGAAACAGGGGAGCGCCCCCAACAAGTGCACACTTCCTGGCCCTTTTGTAGATTGTGGAGAAAGCGCACCGCCGGAGAAAAAACCCCTCAACCGGGGCAACATATTAAGGGAGAAAGGCAAGGGGCGCGCCGGAGGTGGGGGTTTAAAATTTTTATGGGAAATCTCTTTGTGGCAAGGGCGCCAACAGGCGCGGTTCATGCGGGGGGGGTGTTTGTAGTGGGTGTTGTGTGGGTTTGTGNAGTTTACCCCAGGGGNCCCCGCCCAAAGAAGAAGGGGATTATGTATAAGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTGGTCTTTTTCATACAAGGATGG