ORFeome > urad ORF1 – XORFeome v1.0

urad ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: urad
Gene ID: 6255526
Gene Page ID: 5739397
ORF Xenbase ID: 17303781

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC128985
Original XGC clone length: 528

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11090
Well Location: A09

Sequences - 5ʹ (forward) EST

Accession: JZ838606
dbEST ID: 79656308
Trimmed Sequence: ATGGACCTGAACACCATAAACTCCATGAGCTACGAGCAGTTTCTGGACACATTTGGAAATATCATAGAAAGATGCCCCCTCGTCACAGCGGCAATTTGGTCCCAACAGCCATTTGCAAGTGTAACTGAGCTGGAAAACCGCGTCTTTGATTTTATAGAATCCCTCCCTCTGGCTGGGAAAGAAGGAATATTAAGGTGCCACCCTGACTTAGCTGGGAGAGACCTTATGAGAGGAACACTCACTGATGAGTCTCAGAATGAACAAGCTCAAGCAGGACTTACATTGCTCAGTGCCAAAGAGAAAGAGACCCTAGGCTTTCTCAATTTACAGTACAAGGCGAAATTTGGATTCCCCTTTGTCATATGTGCCAAAATGTCTGACAAAAACAAAATAATGCAGGAATTAGGTTCTCGTCTTCAAAATGAGCAGTCGGAGGAGCTTCAGAAAGGCATCGCTGAAGTCAAAAAGATTTGTCATCTGAGAATATGTGATCTGTTCCTTAATGAAAAATTACCTACCAAACTTTT
Full Trace Sequence: GCTCGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGACCTGAACACCATAAACTCCATGAGCTACGAGCAGTTTCTGGACACATTTGGAAATATCATAGAAAGATGCCCCCTCGTCACAGCGGCAATTTGGTCCCAACAGCCATTTGCAAGTGTAACTGAGCTGGAAAACCGCGTCTTTGATTTTATAGAATCCCTCCCTCTGGCTGGGAAAGAAGGAATATTAAGGTGCCACCCTGACTTAGCTGGGAGAGACCTTATGAGAGGAACACTCACTGATGAGTCTCAGAATGAACAAGCTCAAGCAGGACTTACATTGCTCAGTGCCAAAGAGAAAGAGACCCTAGGCTTTCTCAATTTACAGTACAAGGCGAAATTTGGATTCCCCTTTGTCATATGTGCCAAAATGTCTGACAAAAACAAAATAATGCAGGAATTAGGTTCTCGTCTTCAAAATGAGCAGTCGGAGGAGCTTCAGAAAGGCATCGCTGAAGTCAAAAAGATTTGTCATCTGAGAATATGTGATCTGTTCCTTAATGAAAAATTACCTACCAAACTTTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTTACAAAAAAAAAAAAAAAAATCCGGGCAACTCTGGGCCGTGTCTCAAAACCTTCCGAAGTTAAAAANNNGGGGGGGGCCCCGGGGGGGGGGGGGGGGGCTCTCTTCTTGGGGGGGGGGGGGGGGGGGGGCCCCCCCCG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGACCTGAACACCATAAACT

Sequences - 3ʹ (reverse) EST

Accession: JZ838605
dbEST ID: 79656307
Trimmed Sequence: AAGTTTGGTAGGTAATTTTTCATTAAGGAACAGATCACATATTCTCAGATGACAAATCTTTTTGACTTCAGCGATGCCTTTCTGAAGCTCCTCCGACTGCTCATTTTGAAGACGAGAACCTAATTCCTGCATTATTTTGTTTTTGTCAGACATTTTGGCACATATGACAAAGGGGAATCCAAATTTCGCCTTGTACTGTAAATTGAGAAAGCCTAGGGTCTCTTTCTCTTTGGCACTGAGCAATGTAAGTCCTGCTTGAGCTTGTTCATTCTGAGACTCATCAGTGAGTGTTCCTCTCATAAGGTCTCTCCCAGCTAAGTCAGGGTGGCACCTTAATATTCCTTCTTTCCCAGCCAGAGGGAGGGATTCTATAAAATCAAAGACGCGGTTTTCCAGCTCAGTTACACTTGCAAATGGCTGTTGGGACCAAATTGCCGCTGTGACGAGGGGGCATCTTTCTATGATATTTCCAAATGTGTCCAGAAACTGCTCGTAGCTCATGGAGTTTATGGTGTTCAGGTCCCTGG
Full Trace Sequence: AACGGTCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAAGTTTGGTAGGTAATTTTTCATTAAGGAACAGATCACATATTCTCAGATGACAAATCTTTTTGACTTCAGCGATGCCTTTCTGAAGCTCCTCCGACTGCTCATTTTGAAGACGAGAACCTAATTCCTGCATTATTTTGTTTTTGTCAGACATTTTGGCACATATGACAAAGGGGAATCCAAATTTCGCCTTGTACTGTAAATTGAGAAAGCCTAGGGTCTCTTTCTCTTTGGCACTGAGCAATGTAAGTCCTGCTTGAGCTTGTTCATTCTGAGACTCATCAGTGAGTGTTCCTCTCATAAGGTCTCTCCCAGCTAAGTCAGGGTGGCACCTTAATATTCCTTCTTTCCCAGCCAGAGGGAGGGATTCTATAAAATCAAAGACGCGGTTTTCCAGCTCAGTTACACTTGCAAATGGCTGTTGGGACCAAATTGCCGCTGTGACGAGGGGGCATCTTTCTATGATATTTCCAAATGTGTCCAGAAACTGCTCGTAGCTCATGGAGTTTATGGTGTTCAGGTCCCTGGTGCCCACTTTTTTGTACAAAGTTGGCATTATAAAAAAACATTGCTCATCAATTTGTTTTCAACAACGGGGCCCCTATCAATCAAAATAAAATAAATAAAATAGGGCCCGAAGCTTAAAAACGCCCCTTCTTTTCAGGCGCCCCTTTAAACGGGGGTGGGGGCAACCAAAGGTCCCGGCCCGTCCCTTCTCCTTGTGTGAGTTGTGGAGGGAGAAACCCCCGTGGGGAGGAAGCCACGGCGGGCCGTCGGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAAGTTTGGTAGGTAATTTTTC