ORFeome > usb1 ORF1 – XORFeome v1.0

usb1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: usb1
Gene ID: 6251623
Gene Page ID: 948669
ORF Xenbase ID: 17303811

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC043765
Original XGC clone length: 753

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11010
Well Location: C12

Sequences - 5ʹ (forward) EST

Accession: JZ823815
dbEST ID: 79641517
Trimmed Sequence: ATGGCTTTGGTGAGTTACAGCAGTTCAGAAGAGGATGAGGGCGAAACATCTGAACCCCCAGGAAGGCGTCTTCCTCCTCTTCCTCCTCCAACAACTGTTTTAAGGATGTTCCAAGATATGGAGGGTGATGAGGACCTTGATGAGAACACAAAACATGAAGGCAGAATTCGCAGCTTCAAACATGAACGAGGCAACTGGGCTACCTATGTTTATATACCTTTTCAGCCACAAGAGGAGTTTTTGGATTTGTTGGATGAACTTGTTTCTGTAGCTGCAGAAAATGGAGTCCTCTTGACTAAAATGAGTGAATTTCATATCAGCCAGTCACAAACAGTAGTTCTTCGACATCACTGGATCAATCCATTTGTAGAATCACTCAAGGATAAGCTACACTGCATGTACAGATTTCTGTGCATTGCTGAACGGATCAAGGTCTACACCAACCAAGAGAAAACCAGAACATTCCTGGGACTAGAGGTCAGTGTGGGGATGGAGCATCTTTTGGAGGTTGTGTCAGAAGTGGACCGGTCCTTGCAGGAATTTAATCTGCAAACCTTCTATCAGGAGCCTTCCTTTCATGTGAGCCTTGCTTGGTGTGTGGGGGACAAATATGAGAAATTAAAAGGAAGTTGTCTGTTAGAACTTCAGAAAGTCATAGACAGATTTGAGGATTCCGACACACTGACACGGTTATATGCTGAAAAGATTCGTTGCAAAGCTGGAAACAAAACTTTCTGTATTTCTCTGCTATGGCCAACTTTTCTTGTACAAAAGTGGGCATTTAAAAAAAAACATTGGCT
Full Trace Sequence: CAGTATTGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCTTTGGTGAGTTACAGCAGTTCAGAAGAGGATGAGGGCGAAACATCTGAACCCCCAGGAAGGCGTCTTCCTCCTCTTCCTCCTCCAACAACTGTTTTAAGGATGTTCCAAGATATGGAGGGTGATGAGGACCTTGATGAGAACACAAAACATGAAGGCAGAATTCGCAGCTTCAAACATGAACGAGGCAACTGGGCTACCTATGTTTATATACCTTTTCAGCCACAAGAGGAGTTTTTGGATTTGTTGGATGAACTTGTTTCTGTAGCTGCAGAAAATGGAGTCCTCTTGACTAAAATGAGTGAATTTCATATCAGCCAGTCACAAACAGTAGTTCTTCGACATCACTGGATCAATCCATTTGTAGAATCACTCAAGGATAAGCTACACTGCATGTACAGATTTCTGTGCATTGCTGAACGGATCAAGGTCTACACCAACCAAGAGAAAACCAGAACATTCCTGGGACTAGAGGTCAGTGTGGGGATGGAGCATCTTTTGGAGGTTGTGTCAGAAGTGGACCGGTCCTTGCAGGAATTTAATCTGCAAACCTTCTATCAGGAGCCTTCCTTTCATGTGAGCCTTGCTTGGTGTGTGGGGGACAAATATGAGAAATTAAAAGGAAGTTGTCTGTTAGAACTTCAGAAAGTCATAGACAGATTTGAGGATTCCGACACACTGACACGGTTATATGCTGAAAAGATTCGTTGCAAAGCTGGAAACAAAACTTTCTGTATTTCTCTGCTATGGCCAACTTTTCTTGTACAAAAGTGGGCATTTAAAAAAAAACATTGGCT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTTTGGTGAGTTACAG

Sequences - 3ʹ (reverse) EST

Accession: JZ829124
dbEST ID: 79646826
Trimmed Sequence: TAGCAGAGGAATACAGAAAGTTTTGTTTCCAGCTTTGCAACGAATCTCTTCAGCATTAAACCGTGTCAGTGTGTCGGAATCCTCAAATCTGTCTATGACTTTCTGAAGTTCTAACAGACAACTTCCTTTTAATTTCTCATATTTGTCCCCCACACACCAAGCAAGGCTCACATGAAAGGAAGGCTCCTGATAGAAGGTTTGCAGATTAAATTCCTGCAAGGACCGGTCCACTTCTGACACAACCTCCAAAAGATGCTCCATCCCCACACTGACCTCTAGTCCCAGGAATGTTCTGGTTTTCTCTTGGTTGGTGTAGACCTTGATCCGTTCAGCAATGCACAGAAATCTGTACATGCAGTGTAGCTTATCCTTGAGTGATTCTACAAATGGATTGATCCAGTGATGTCGAAGAACTACTGTTTGTGACTGGCTGATATGAAATTCACTCATTTTAGTCAAGAGGACTCCATTTTCTGCAGCTACAGAAACAAGTTCATCCAACAAATCCAAAAACTCCTCTTGTGGCTGAAAAGGTATATAAACATAGGTAGCCCAGTTGCCTCGTTCATGTTTGAAGCTGCGAATTCTGCCTTCATGTTTTGTGTTCTCATCAAGGTCCTCATCACCCTCCATATCTTGGGACATCCTTAAAACAGTTGTTTGGAGGAGGAAAGAGGAAGAAGGACGCCTTCCGGGGGGGGTTCAGAAGGTTTTCCGCCCTCATTCCTCCTTCCGGAACTGGCTGTAAACTTCCCCCCAAACCCCCGGGGTGG
Full Trace Sequence: ACGGGTATCAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATAGCAGAGGAATACAGAAAGTTTTGTTTCCAGCTTTGCAACGAATCTCTTCAGCATTAAACCGTGTCAGTGTGTCGGAATCCTCAAATCTGTCTATGACTTTCTGAAGTTCTAACAGACAACTTCCTTTTAATTTCTCATATTTGTCCCCCACACACCAAGCAAGGCTCACATGAAAGGAAGGCTCCTGATAGAAGGTTTGCAGATTAAATTCCTGCAAGGACCGGTCCACTTCTGACACAACCTCCAAAAGATGCTCCATCCCCACACTGACCTCTAGTCCCAGGAATGTTCTGGTTTTCTCTTGGTTGGTGTAGACCTTGATCCGTTCAGCAATGCACAGAAATCTGTACATGCAGTGTAGCTTATCCTTGAGTGATTCTACAAATGGATTGATCCAGTGATGTCGAAGAACTACTGTTTGTGACTGGCTGATATGAAATTCACTCATTTTAGTCAAGAGGACTCCATTTTCTGCAGCTACAGAAACAAGTTCATCCAACAAATCCAAAAACTCCTCTTGTGGCTGAAAAGGTATATAAACATAGGTAGCCCAGTTGCCTCGTTCATGTTTGAAGCTGCGAATTCTGCCTTCATGTTTTGTGTTCTCATCAAGGTCCTCATCACCCTCCATATCTTGGGACATCCTTAAAACAGTTGTTTGGAGGAGGAAAGAGGAAGAAGGACGCCTTCCGGGGGGGGTTCAGAAGGTTTTCCGCCCTCATTCCTCCTTCCGGAACTGGCTGTAAACTTCCCCCCAAACCCCCGGGGTGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATAGCAGAGGAATACAGAAAGTTTT