ORFeome > usp16 ORF1 – XORFeome v1.0

usp16 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: usp16
Gene ID: 1007170
Gene Page ID: 1007163
ORF Xenbase ID: 17303877

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC060022
Original XGC clone length: 2706

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11019
Well Location: D06

Sequences - 5ʹ (forward) EST

Accession: JZ824510
dbEST ID: 79642212
Trimmed Sequence: ATGGTAAAGAAGAGAGGGACGAACCTCCCCGCCCAGGACTTTCTTGATGCAGAACCTGTGTGCAAGCACCTGCGGAAGGCCCTGGATGATGGAAGTGTGAAGAGGGCGCTGGTGAATGTGGAATGGACAATGTGCCAGGACTGCCAGGCAGACAACAAGGAGAAGAATAACTCAGAGGATGAGTCGGCTGAAGACCCTTCTGTCTGGCTGTGTTTAAAATGTGGACATCGGGGCTGTGGCAGAAATTCAGTGGCCCAGCATGCACTGAACCATTACAACACCCCCAGGTCAGAACCACACTGCCTGGTCCTTAACGTTGATATGTGGAGTGCATGGTGCTACTTATGCGACAATGAGGTTCCCTATAACCGCACTAGTCGGTTAGGCCAGCTGGTGGATTATTTGCAAAGAAAAGCCAAGGCAAAAAACAAAAATTCTAATTCAGTAGTCTCGAATGAAGAAGTTAAAACTGAAATCGTGACTGAGAATGAAGTCAAGAAGATTCAGTATCAAGATGAGAAGCCCGATGTTCAAGCCAAACAGGAAAAAGCCAGCAGTACCCAGAAAATTAGTACCGAGCCTACAGTGAAAGGACTTAGCAATTTGGGGAACACGTGTTTTTTCAATGCAGTGATGCAGAACCTATCCCAGACCCCTGCTTTAAGCGAACTTCTAAATGAGGTTAAGACATTTAGAAAACCAGTGACTGTCCTACTGCCGGATTCATCATCTCCTAAAATTCTAGAGGTAAATCTAGAGCAGCAAGCAGGGACCACTGGACCTTGGGCATGTTGTGCAATTCCCTGACTGAAATTGCATGAAAA
Full Trace Sequence: AATAGTGGAATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGTAAAGAAGAGAGGGACGAACCTCCCCGCCCAGGACTTTCTTGATGCAGAACCTGTGTGCAAGCACCTGCGGAAGGCCCTGGATGATGGAAGTGTGAAGAGGGCGCTGGTGAATGTGGAATGGACAATGTGCCAGGACTGCCAGGCAGACAACAAGGAGAAGAATAACTCAGAGGATGAGTCGGCTGAAGACCCTTCTGTCTGGCTGTGTTTAAAATGTGGACATCGGGGCTGTGGCAGAAATTCAGTGGCCCAGCATGCACTGAACCATTACAACACCCCCAGGTCAGAACCACACTGCCTGGTCCTTAACGTTGATATGTGGAGTGCATGGTGCTACTTATGCGACAATGAGGTTCCCTATAACCGCACTAGTCGGTTAGGCCAGCTGGTGGATTATTTGCAAAGAAAAGCCAAGGCAAAAAACAAAAATTCTAATTCAGTAGTCTCGAATGAAGAAGTTAAAACTGAAATCGTGACTGAGAATGAAGTCAAGAAGATTCAGTATCAAGATGAGAAGCCCGATGTTCAAGCCAAACAGGAAAAAGCCAGCAGTACCCAGAAAATTAGTACCGAGCCTACAGTGAAAGGACTTAGCAATTTGGGGAACACGTGTTTTTTCAATGCAGTGATGCAGAACCTATCCCAGACCCCTGCTTTAAGCGAACTTCTAAATGAGGTTAAGACATTTAGAAAACCAGTGACTGTCCTACTGCCGGATTCATCATCTCCTAAAATTCTAGAGGTAAATCTAGAGCAGCAAGCAGGGACCACTGGACCTTGGGCATGTTGTGCAATTCCCTGACTGAAATTGCATGAAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGTAAAGAAGAGAGGGACGA

Sequences - 3ʹ (reverse) EST

Accession: JZ829863
dbEST ID: 79647565
Trimmed Sequence: CAGCATTCGCTCATAGAAGAGCAGGTAAGCCTGGGAGCTCAGCACTCTGGAAAGGGACACTGCTTGGACGTGGCTGTCGCTTATGTGGTACCAACTGCCTTGCCCAGGTTCACTTCCCGAGACTTCTGGAATGACTCCGGTAAATAACATCTTGCAGAGCTGCTGGTTCGGGTGACGCAGTTTGACGAACGCGGTGTAATGGCCGGACCTCATGCTGCCGCTGTGCTCGATAACGCCGTACAGGGAATAGAGTAACCGCGACTCTCCTTCAGGAACGTTCTTACATTTTGCTGTGCAGAATGGAGCCAGGTCTAGCACCTCAGGGAACTTTATATGCCTGTTAATCTTCCGTAAATTAAAGCCATTCTGCTGGAACCTCTTCAAATGGAGAGTGAGGATGGGAGAGGGGTTCGACACCAACATTTGCTTCTTAGCATTTGTGTAAACAAACTTCTTCTCCCCTTTATTACTGTTGTTCAGCCTGCTGGCCTGTTTCCGGGTGCAGACATTACAGAGCAGCTTGTTGTTCCCAGTGAGGGTCTCTTTGTGAGTAAACTGATAGAGGCAACTGAGCACAGAAAACTCATCTATTGGCAGATCCTTCCTATTAGAAAGGGTACTGAATGCAGTTTTGGGGTCTTC
Full Trace Sequence: GGACCGGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACAGCATTCGCTCATAGAAGAGCAGGTAAGCCTGGGAGCTCAGCACTCTGGAAAGGGACACTGCTTGGACGTGGCTGTCGCTTATGTGGTACCAACTGCCTTGCCCAGGTTCACTTCCCGAGACTTCTGGAATGACTCCGGTAAATAACATCTTGCAGAGCTGCTGGTTCGGGTGACGCAGTTTGACGAACGCGGTGTAATGGCCGGACCTCATGCTGCCGCTGTGCTCGATAACGCCGTACAGGGAATAGAGTAACCGCGACTCTCCTTCAGGAACGTTCTTACATTTTGCTGTGCAGAATGGAGCCAGGTCTAGCACCTCAGGGAACTTTATATGCCTGTTAATCTTCCGTAAATTAAAGCCATTCTGCTGGAACCTCTTCAAATGGAGAGTGAGGATGGGAGAGGGGTTCGACACCAACATTTGCTTCTTAGCATTTGTGTAAACAAACTTCTTCTCCCCTTTATTACTGTTGTTCAGCCTGCTGGCCTGTTTCCGGGTGCAGACATTACAGAGCAGCTTGTTGTTCCCAGTGAGGGTCTCTTTGTGAGTAAACTGATAGAGGCAACTGAGCACAGAAAACTCATCTATTGGCAGATCCTTCCTATTAGAAAGGGTACTGAATGCAGTTTTGGGGTCTTC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACAGCATTCGCTCATAGAAGAGCA