ORFeome > usp3 ORF1 – XORFeome v1.0

usp3 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: usp3
Gene ID: 962765
Gene Page ID: 962758
ORF Xenbase ID: 17303901

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC126023
Original XGC clone length: 1569

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11083
Well Location: G05

Sequences - 5ʹ (forward) EST

Accession: JZ837406
dbEST ID: 79655108
Trimmed Sequence: ATGGAGTGCCCGCACCTGACCACCAGTGTTTGTATTGCCCCGGACTCCGCCGTTTTCCCCAACGGCTGTCCTTCCTCGTGGTGCTGCAGCGTTTGTCGCTCAAACAAGAGTCCATGGGTCTGTTTGACATGTTCCAGTGTCCACTGTGGAAGATATGTAAATGGTCATGCAAAAAAGCATTATGAGGATGCCCAGGCTCCACTCAGTAGCCACAAACGTCAGGAAAAGACAGAAAAGGAACGAACGCAGCATACAGTATGCATGGACTGCAGAAGTTACAGTACGTATTGTTACCGATGTGATGATTTTGTGGTAAATGATACAAAATTGTGTTTAATACAGAAGGTCCGGGAGCATTTGCAGAATTTGGAAAACTCTGCTTTTACTGCTGAGCGGCATAGAAAAAGAAAATTCCTGGAGAGTGCCTCGCTGAGCAAGAAATTGTTGAAAGTAAATGGAAGCACAACTGCTCTATGTGCTACTGGCCTTCGGAATCTTGGAAATACCTGCTTTATGAATGCAATTCTTCAATCACTCAGCAACATTCAGCAGTTTTGCTGTTACTTCAAGGAATTGCCTGCTGTGGAACTTCGGAATGGTAAAACTGCCGGCCGGCGAACCTACCATACACGAACCCAAGGGGATGTTAATGTGTCACTGGTTGAGGAATTTAGAAAAACCTTGTGTGCATTAGGGGCAGGTTACCCAAACTGGCCTTTAGTCCTGAATCTTTTTTTCTTTGTTTTTGTGGAAAATAGTTGGGGAAAATTTCCGGGGAAAAACAGCAGCCAAAAGTCCCCACCAAAGTTATATGCGGTTT
Full Trace Sequence: GGAGGGCCCCAATAANTGATTTTANTTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAGTGCCCGCACCTGACCACCAGTGTTTGTATTGCCCCGGACTCCGCCGTTTTCCCCAACGGCTGTCCTTCCTCGTGGTGCTGCAGCGTTTGTCGCTCAAACAAGAGTCCATGGGTCTGTTTGACATGTTCCAGTGTCCACTGTGGAAGATATGTAAATGGTCATGCAAAAAAGCATTATGAGGATGCCCAGGCTCCACTCAGTAGCCACAAACGTCAGGAAAAGACAGAAAAGGAACGAACGCAGCATACAGTATGCATGGACTGCAGAAGTTACAGTACGTATTGTTACCGATGTGATGATTTTGTGGTAAATGATACAAAATTGTGTTTAATACAGAAGGTCCGGGAGCATTTGCAGAATTTGGAAAACTCTGCTTTTACTGCTGAGCGGCATAGAAAAAGAAAATTCCTGGAGAGTGCCTCGCTGAGCAAGAAATTGTTGAAAGTAAATGGAAGCACAACTGCTCTATGTGCTACTGGCCTTCGGAATCTTGGAAATACCTGCTTTATGAATGCAATTCTTCAATCACTCAGCAACATTCAGCAGTTTTGCTGTTACTTCAAGGAATTGCCTGCTGTGGAACTTCGGAATGGTAAAACTGCCGGCCGGCGAACCTACCATACACGAACCCAAGGGGATGTTAATGTGTCACTGGTTGAGGAATTTAGAAAAACCTTGTGTGCATTAGGGGCAGGTTACCCAAACTGGCCTTTAGTCCTGAATCTTTTTTTCTTTGTTTTTGTGGAAAATAGTTGGGGAAAATTTCCGGGGAAAAACAGCAGCCAAAAGTCCCCACCAAAGTTATATGCGGTTT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAGTGCCCGCACCTGA

Sequences - 3ʹ (reverse) EST

Accession: JZ837405
dbEST ID: 79655107
Trimmed Sequence: TAGTTTCTCAGTTGTGGCAGGAACCTGGCGTTCCACATAAAAAAGAATATAGGCTTTTGCTTTTGCCACAGTCTCCTCTTCTGTAAGTGTCACTGTGCTGTCATTGAAATGGAACCAGCGCCCTTCATGGGTGGCATAGGCAGTGTAGTGACCAGACCCAACACCCGAGCCATGATGAACAACTACAGCTTCAAGATCATACAGACAGCTTTCTGGACCAATATTTTCTGGCTCTAACAAAAATGACTTCATATCCAATCCTCGTAGAGGAAAATCTACATATGTGTCCACTTTGTTCCTCAAGTAGGCTGTCCAATGGAACCTCTTCAAGTGTAGGCAAAGCACCTTTGGTAGTTTCTGGATCCAAAACTTTTTGGTGGACTTCTGTTTCTTTTTGCACTTTAGACATGTGTAGAGTTCTGTCTCATCTAGTTCCTCTAAGTCTGTAAAGCTGCGAAGACAGTCTCGCAGGGTACAGGTTGGTCCATTTTCTTGGTTCTTACAACGCTTGTTTCGGAATTGGCTTGGAATATCTAAAGAAAGGTCTAGGAATGGATCAAATTTTCTTGATTCTGTTCCACAAATTAGGCAGTTAACTTCATTCTGTTAAACTCCCCCAAATACTGAAGTTTACAACGGGGGAATGCACAATTTAAAACACATTTTTTTACTGGACAAAACAAAACTGCAATTTCGCCCTGTGAATAAAAAAGAAATGTGAAAAGAAACCATCAAAAATACCCCCCTTTAATTTACAAGGGGTGGGAAGGTGGGG
Full Trace Sequence: GAAAATGGCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATAGTTTCTCAGTTGTGGCAGGAACCTGGCGTTCCACATAAAAAAGAATATAGGCTTTTGCTTTTGCCACAGTCTCCTCTTCTGTAAGTGTCACTGTGCTGTCATTGAAATGGAACCAGCGCCCTTCATGGGTGGCATAGGCAGTGTAGTGACCAGACCCAACACCCGAGCCATGATGAACAACTACAGCTTCAAGATCATACAGACAGCTTTCTGGACCAATATTTTCTGGCTCTAACAAAAATGACTTCATATCCAATCCTCGTAGAGGAAAATCTACATATGTGTCCACTTTGTTCCTCAAGTAGGCTGTCCAATGGAACCTCTTCAAGTGTAGGCAAAGCACCTTTGGTAGTTTCTGGATCCAAAACTTTTTGGTGGACTTCTGTTTCTTTTTGCACTTTAGACATGTGTAGAGTTCTGTCTCATCTAGTTCCTCTAAGTCTGTAAAGCTGCGAAGACAGTCTCGCAGGGTACAGGTTGGTCCATTTTCTTGGTTCTTACAACGCTTGTTTCGGAATTGGCTTGGAATATCTAAAGAAAGGTCTAGGAATGGATCAAATTTTCTTGATTCTGTTCCACAAATTAGGCAGTTAACTTCATTCTGTTAAACTCCCCCAAATACTGAAGTTTACAACGGGGGAATGCACAATTTAAAACACATTTTTTTACTGGACAAAACAAAACTGCAATTTCGCCCTGTGAATAAAAAAGAAATGTGAAAAGAAACCATCAAAAATACCCCCCTTTAATTTACAAGGGGTGGGAAGGTGGGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATAGTTTCTCAGTTGTGGCAGG