ORFeome > usp7 ORF1 – XORFeome v1.0

usp7 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: usp7
Gene ID: 946617
Gene Page ID: 946611
ORF Xenbase ID: 17303955

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC124900
Original XGC clone length: 1605

Human orthology & disease relationships

NCBI Entrez ID: 7874
Ensembl gene IDs: ENSG00000187555
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 114500,132600,133239,151623,155255,211980,260500,275355,603278

Library Location

Plate ID: GDExl11091
Well Location: G07

Sequences - 5ʹ (forward) EST

Accession: JZ838763
dbEST ID: 79656465
Trimmed Sequence: ATGAACCACCATCAACAGCAACAACAACAGCAGAAACCCGGGGAACAGCAACTCAGTGAACCCGAGGACATGGAGATGGAAGCTGGTGACACTGATGATCCTCCGAGAATCCCTCCAAATCCTGTCATTAATGGAAATGTTGCCATGGCAGATGGTCATAACAACGCAGAAGAGGATATGGAAGATGATACAAGCTGGAGGTCAGAAGCGACATTTCAGTTCACAGTGGAACGTTTCAGTCGTCTAAGTGAATCTGTGCTTAGCCCCCCTTGCTTCGTACGGAATCTTCCTTGGAAAATTATGGTGATGCCACGATTTTATCCAGACCGACCGCATCAGAAAAGTGTGGGATTTTTCCTTCAGTGTAATGCTGAATCTGATTCAACGTCATGGTCCTGTCATGCACAGGCCGTACTGAAGATAATCAATTTCAAAGATGAGGAGAAATTTTTTAGTCGCCGCATAAGTCACCTGTTCTTTCATAAGGAAAATGATTGGGGCTTTTCCAATTTTATGGCATGGAGTGAGGTTACTGATCCAGAAAAAGGTTTTATGGAAGACGACAAGGTGACTTTCGAAGTATATGTGCAGGCTGATGCTCCTCATGGAGTATCGTGGGATTCGAAAAAGCAAACTGGGTATGTTGGAATAAAGAATCAAGGAACAACTTGGTTCATGAATAGTTTATTGCAAACATTATTTTTTTCAACCCACCTTCCAAAGGGCTTTGTATATAATGCCCAAAGGAAGGTAATGACCCCTCATAAAGTGGTCCCTTTCGATTAACACCAAATAATTTTAAAAAAATTAAAACAAG
Full Trace Sequence: TCGAGGCCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAACCACCATCAACAGCAACAACAACAGCAGAAACCCGGGGAACAGCAACTCAGTGAACCCGAGGACATGGAGATGGAAGCTGGTGACACTGATGATCCTCCGAGAATCCCTCCAAATCCTGTCATTAATGGAAATGTTGCCATGGCAGATGGTCATAACAACGCAGAAGAGGATATGGAAGATGATACAAGCTGGAGGTCAGAAGCGACATTTCAGTTCACAGTGGAACGTTTCAGTCGTCTAAGTGAATCTGTGCTTAGCCCCCCTTGCTTCGTACGGAATCTTCCTTGGAAAATTATGGTGATGCCACGATTTTATCCAGACCGACCGCATCAGAAAAGTGTGGGATTTTTCCTTCAGTGTAATGCTGAATCTGATTCAACGTCATGGTCCTGTCATGCACAGGCCGTACTGAAGATAATCAATTTCAAAGATGAGGAGAAATTTTTTAGTCGCCGCATAAGTCACCTGTTCTTTCATAAGGAAAATGATTGGGGCTTTTCCAATTTTATGGCATGGAGTGAGGTTACTGATCCAGAAAAAGGTTTTATGGAAGACGACAAGGTGACTTTCGAAGTATATGTGCAGGCTGATGCTCCTCATGGAGTATCGTGGGATTCGAAAAAGCAAACTGGGTATGTTGGAATAAAGAATCAAGGAACAACTTGGTTCATGAATAGTTTATTGCAAACATTATTTTTTTCAACCCACCTTCCAAAGGGCTTTGTATATAATGCCCAAAGGAAGGTAATGACCCCTCATAAAGTGGTCCCTTTCGATTAACACCAAATAATTTTAAAAAAATTAAAACAAG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAACCACCATCAACAGCAA

Sequences - 3ʹ (reverse) EST

Accession: JZ838762
dbEST ID: 79656464
Trimmed Sequence: TATTTTAGATTTTGGCACACACTTACTGAGTTTGGATTCCCTGATATAAACTAACATATAAGCATTTGTGCAGTGTCGCACAGATAAGTCATCATCATGGCCTCCATAGTTGTGTTCGATTGCCTCTTCTTTTGTACATCTTGACACTACATCGTCGTCAAATTTACACCATTTGCCTTCTCCTTTAGGATTCAAATAAACAACATAGTGCCCTCCATGGTTGTCTCCACTGTGCACCAAGACTGCGTGCAAAATGTAGTTAGCAGGATCCTTGCTATCTGGCTTTTGGAGAAATTCATCCAGCGGCAACTGTTCTGGAAATTCAAATCTGTCATTGATCTTAATATTTTGGTCTGTTTGAGGGTCATACATAAATCTCATAAGTTGAAGATGTAATACAGGTGGGAAAGTTAGAAACTTGACCCCTTTTTCTGCTTCCTGTAAGCCGTGTTCTCCTGCATCGTATTTGTTATCACCATCAAGCTGCTCCACTGCTACATAGTCAATGAAGGACTCAAATATGTTTTTCTTTCCCTTTATACTTAGCTGGATATCATAATAATCTTCTATGCGTTCAGACCGATAGTCTACATGCTTGCACTGTATATAAGACACCATCTTTCCTCTAAATAACTTAGGTATGGTTCCTTCTACACATGTGCCTTTTCATTTTGTTTTCAACATTATCAATTAACACTCTACATAAATTCTTGGAACCTCATGCCTGCAGGAAAGCCTGTCCTAAGGTCTCCCACCCCCAAATGAATTTTTT
Full Trace Sequence: AAACAGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATATTTTAGATTTTGGCACACACTTACTGAGTTTGGATTCCCTGATATAAACTAACATATAAGCATTTGTGCAGTGTCGCACAGATAAGTCATCATCATGGCCTCCATAGTTGTGTTCGATTGCCTCTTCTTTTGTACATCTTGACACTACATCGTCGTCAAATTTACACCATTTGCCTTCTCCTTTAGGATTCAAATAAACAACATAGTGCCCTCCATGGTTGTCTCCACTGTGCACCAAGACTGCGTGCAAAATGTAGTTAGCAGGATCCTTGCTATCTGGCTTTTGGAGAAATTCATCCAGCGGCAACTGTTCTGGAAATTCAAATCTGTCATTGATCTTAATATTTTGGTCTGTTTGAGGGTCATACATAAATCTCATAAGTTGAAGATGTAATACAGGTGGGAAAGTTAGAAACTTGACCCCTTTTTCTGCTTCCTGTAAGCCGTGTTCTCCTGCATCGTATTTGTTATCACCATCAAGCTGCTCCACTGCTACATAGTCAATGAAGGACTCAAATATGTTTTTCTTTCCCTTTATACTTAGCTGGATATCATAATAATCTTCTATGCGTTCAGACCGATAGTCTACATGCTTGCACTGTATATAAGACACCATCTTTCCTCTAAATAACTTAGGTATGGTTCCTTCTACACATGTGCCTTTTCATTTTGTTTTCAACATTATCAATTAACACTCTACATAAATTCTTGGAACCTCATGCCTGCAGGAAAGCCTGTCCTAAGGTCTCCCACCCCCAAATGAATTTTTT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATATTTTAGATTTTGGCACACACTT