ORFeome > utp11l ORF1 – XORFeome v1.0

utp11l ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: utp11l
Gene ID: 992340
Gene Page ID: 992333
ORF Xenbase ID: 17303967

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC078583
Original XGC clone length: 762

Human orthology & disease relationships

NCBI Entrez ID: 51118
Ensembl gene IDs: ENSG00000183520
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 137760,604901,609887

Library Location

Plate ID: GDExl11004
Well Location: F09

Sequences - 5ʹ (forward) EST

Accession: JZ839651
dbEST ID: 79657353
Trimmed Sequence: ATGGCTGCTGCATTTAGAAAGGCTTTGAAGTCCCGGCAAAGGGATCACAAGGAGAGATCTCAGCCTGGTTTCCGCAAGAATCTAGGACTTTTGGAAAAGAAAAAAGACTACAAACTTCGAGCTGAAGACTATCGGAAGAAAAGGAATACTCTCAATGCCTTGCGAAAGAAAGCCCTCGACAAAAACCCAGATGAATTCTACTTTAAGATGACATCATCCAAACAGGAGGATGGTGTCCATGTTATAAAGCAAAAGACTGAGGAGGTCACAGATGAACAGGCTAAAGTGATGCGGACGCAGGACATAAAGTATGTGGAGATGAAGAGAGTAGCAGAGGCTAAGAAAATCGAAAGACTGAAGTCTGAGCTCCATCTGCTGGAAACGGAGGGGAACCAAAGAAACACTCATACCTTTTTCTGTGACAGTAAGAAAGAAGTACTCCAGTTTGATCTGGCAGCTCAACTGAAAACAGCCCCAGAGCTTGTGAACAGAGTGTACAACAGACCTACATTAGAAACTCTGCACAAAGAGGCTGTAAAGGGAGAAGCAACCCCCCAGCAATTGAAACGACTAGCANAAAAGAGACTGCATGAATATGATGTTCTAAAGCAGCGAATTGAACGAGAAAGGAAAATGTTTGTCATATCTCAGAAGATACAGTCACGAAAAGACTTGTTGGACAAAAGGGAGAAAGTTAAAGTAAGAAAGAAACTGTGGAATCCCCAACCATATACAAATTTAAAATGCCAACGTCCGCGATTGGCCAACTTTTCTTGTACCAA
Full Trace Sequence: GCCACCAAATAATAGATTTTATTTTAGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCTGCTGCATTTAGAAAGGCTTTGAAGTCCCGGCAAAGGGATCACAAGGAGAGATCTCAGCCTGGTTTCCGCAAGAATCTAGGACTTTTGGAAAAGAAAAAAGACTACAAACTTCGAGCTGAAGACTATCGGAAGAAAAGGAATACTCTCAATGCCTTGCGAAAGAAAGCCCTCGACAAAAACCCAGATGAATTCTACTTTAAGATGACATCATCCAAACAGGAGGATGGTGTCCATGTTATAAAGCAAAAGACTGAGGAGGTCACAGATGAACAGGCTAAAGTGATGCGGACGCAGGACATAAAGTATGTGGAGATGAAGAGAGTAGCAGAGGCTAAGAAAATCGAAAGACTGAAGTCTGAGCTCCATCTGCTGGAAACGGAGGGGAACCAAAGAAACACTCATACCTTTTTCTGTGACAGTAAGAAAGAAGTACTCCAGTTTGATCTGGCAGCTCAACTGAAAACAGCCCCAGAGCTTGTGAACAGAGTGTACAACAGACCTACATTAGAAACTCTGCACAAAGAGGCTGTAAAGGGAGAAGCAACCCCCCAGCAATTGAAACGACTAGCANAAAAGAGACTGCATGAATATGATGTTCTAAAGCAGCGAATTGAACGAGAAAGGAAAATGTTTGTCATATCTCAGAAGATACAGTCACGAAAAGACTTGTTGGACAAAAGGGAGAAAGTTAAAGTAAGAAAGAAACTGTGGAATCCCCAACCATATACAAATTTAAAATGCCAACGTCCGCGATTGGCCAACTTTTCTTGTACCAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTGCTGCATTTAGAAAGG

Sequences - 3ʹ (reverse) EST

Accession: JZ839650
dbEST ID: 79657352
Trimmed Sequence: TCGCTGACGTTGCATTTTAAACTTGTATATTGCTGGGGAATCCACAGTTTCTTTCTTAACTTTAACTTTCTCCCTTTTGTCCAACAAGTCTTTTCGTGACTGTATCTTCTGAGATATGACAAACATTTTCCTTTCTCGTTCAATTCGCTGCTTTAGAACATCATATTCATGCAGTCTCTTTTTTGCTAGTCGTTTCAATTGCTGGGGGGTTGCTTCTCCCTTTACAGCCTCTTTGTGCAGAGTTTCTAATGTAGGTCTGTTGTACACTCTGTTCACAAGCTCTGGGGCTGTTTTCAGTTGAGCTGCCAGATCAAACTGGAGTACTTCTTTCTTACTGTCACAGAAAAAGGTATGAGTGTTTCTTTGGTTCCCCTCCGTTTCCAGCAGATGGAGCTCAGACTTCAGTCTTTCGATTTTCTTAGCCTCTGCTACTCTCTTCATCTCCACATACTTTATGTCCTGCGTCCGCATCACTTTAGCCTGTTCATCTGTGACCTCCTCAGTCTTTTGCTTTATAACATGGACACCATCCTCCTGTTTGGATGATGTCATCTTAGAGTAGAATTCATCTGGGGTTTTTGTCGAGGGCTTTCTTTCGCAAGGCATTNGAGAGTATTCCTTTTCTTCCCATAATCTTCAGCTCGAAATTTGTAGTC
Full Trace Sequence: AAAAGGTCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATCGCTGACGTTGCATTTTAAACTTGTATATTGCTGGGGAATCCACAGTTTCTTTCTTAACTTTAACTTTCTCCCTTTTGTCCAACAAGTCTTTTCGTGACTGTATCTTCTGAGATATGACAAACATTTTCCTTTCTCGTTCAATTCGCTGCTTTAGAACATCATATTCATGCAGTCTCTTTTTTGCTAGTCGTTTCAATTGCTGGGGGGTTGCTTCTCCCTTTACAGCCTCTTTGTGCAGAGTTTCTAATGTAGGTCTGTTGTACACTCTGTTCACAAGCTCTGGGGCTGTTTTCAGTTGAGCTGCCAGATCAAACTGGAGTACTTCTTTCTTACTGTCACAGAAAAAGGTATGAGTGTTTCTTTGGTTCCCCTCCGTTTCCAGCAGATGGAGCTCAGACTTCAGTCTTTCGATTTTCTTAGCCTCTGCTACTCTCTTCATCTCCACATACTTTATGTCCTGCGTCCGCATCACTTTAGCCTGTTCATCTGTGACCTCCTCAGTCTTTTGCTTTATAACATGGACACCATCCTCCTGTTTGGATGATGTCATCTTAGAGTAGAATTCATCTGGGGTTTTTGTCGAGGGCTTTCTTTCGCAAGGCATTNGAGAGTATTCCTTTTCTTCCCATAATCTTCAGCTCGAAATTTGTAGTC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATCGCTGACGTTGCATTTTAAACT