ORFeome > utp15 ORF1 – XORFeome v1.0

utp15 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: utp15
Gene ID: 866061
Gene Page ID: 491402
ORF Xenbase ID: 17303979

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC044048
Original XGC clone length: 1548

Human orthology & disease relationships

NCBI Entrez ID: 84135
Ensembl gene IDs: ENSG00000164338
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 137760,604901,609887

Library Location

Plate ID: GDExl11018
Well Location: C01

Sequences - 5ʹ (forward) EST

Accession: JZ824427
dbEST ID: 79642129
Trimmed Sequence: ATGTCAAGTTACAAGCCTTTAGCCATCCCCACTTACCCCAAGCTTGGTGAGAAGATAACACAGGATACTTTGTACTGGAAACGTTACAAGACACCTGTTCAGATTAAAGAATTTGGAGCAGTAACAAAAATCCACTTTTCGCCTATTCAGCCTTTCAGCTATGCTGTAACTTCATCCACTCGGATTCACCTCTATGGACAGTACTCTCAGGAGCCTGTGAAAACCTTCTCTCGCTTCAAAGACACTGCCTATTGTGGGACCTATCGGGGAGATGGGAAGCTTCTTGCAGCCGGCTGTGAAGATAGTGTTGTCCAGCTCTTTGATATCAGTGGAAAAGCTGCACTTAGACAATTTTCTGGCCATAGCAAAGCAGTGCACTTTGTAGACTTTACCTCAGATAAGTATCGTATTGTGTCTGGTTCTGATGACTACACATCCAAACTCTGGGATATTCCGAATGGCATAGAAATCGCTAGCTACAAGGAGCACACAGACTATATTCGATGTGGCTGCACCAGCTCGCTGAATAATGATTTGTTTGCTACAGGTTCGTATGATCATACCATTAAAGTATTTGATGGACGAACAGACAAGAGTGTAATGAGTATGGATCATGGGCAGCCTGGTGGAGAGTGTTCTTCTCTTCCCTTCTNGGGGGCCTCTTGTTTCTGCANGTGGCCGATATGTTTAAGGTGTGGGACATACTAAAAGGAGGGCAATTTCTTGGGGTCATTAAAAAACATCCCCAAACAATGAAAAGTTCGTTGTTCTTAACACCTCTGGCCAAAAGGTGGCTGTCCGGTCCATTTAAAA
Full Trace Sequence: CAATATTGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCAAGTTACAAGCCTTTAGCCATCCCCACTTACCCCAAGCTTGGTGAGAAGATAACACAGGATACTTTGTACTGGAAACGTTACAAGACACCTGTTCAGATTAAAGAATTTGGAGCAGTAACAAAAATCCACTTTTCGCCTATTCAGCCTTTCAGCTATGCTGTAACTTCATCCACTCGGATTCACCTCTATGGACAGTACTCTCAGGAGCCTGTGAAAACCTTCTCTCGCTTCAAAGACACTGCCTATTGTGGGACCTATCGGGGAGATGGGAAGCTTCTTGCAGCCGGCTGTGAAGATAGTGTTGTCCAGCTCTTTGATATCAGTGGAAAAGCTGCACTTAGACAATTTTCTGGCCATAGCAAAGCAGTGCACTTTGTAGACTTTACCTCAGATAAGTATCGTATTGTGTCTGGTTCTGATGACTACACATCCAAACTCTGGGATATTCCGAATGGCATAGAAATCGCTAGCTACAAGGAGCACACAGACTATATTCGATGTGGCTGCACCAGCTCGCTGAATAATGATTTGTTTGCTACAGGTTCGTATGATCATACCATTAAAGTATTTGATGGACGAACAGACAAGAGTGTAATGAGTATGGATCATGGGCAGCCTGGTGGAGAGTGTTCTTCTCTTCCCTTCTNGGGGGCCTCTTGTTTCTGCANGTGGCCGATATGTTTAAGGTGTGGGACATACTAAAAGGAGGGCAATTTCTTGGGGTCATTAAAAAACATCCCCAAACAATGAAAAGTTCGTTGTTCTTAACACCTCTGGCCAAAAGGTGGCTGTCCGGTCCATTTAAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCAAGTTACAAGCCTTTAGCC

Sequences - 3ʹ (reverse) EST

Accession: JZ829784
dbEST ID: 79647486
Trimmed Sequence: CTGGGAACCGAGAGGCAGTATTGGTTTGGGTTCCTCCCATGGACTCTCTTTTTTCGTTGTCATTGTGGCAAACAATGTGTCCATCATTCCCAATATTTTTAAGAGTTCCTCCTGGTAGTTAATTTCTTTTTCTACCACTTCTTGAAGCCTGATAAATTGTTTATGGATTACAGAAGACTGGCCCACTACAGGAGAATAGATATCTATAATGTGCTCTGCCACATTTAATAGAATTGGTAGAAACAGAGGATTTACCAGATGTTTGAGAAGGAAAATGAGCAGGTCACTCAACTCCTTTTCATTTCTTCCAGCAAGAGCATTTTTAAGAGTCCCCCTTCTTTTTAGTTCATTCATGACTGCAACAGTGACTTCAGGCTTTTTCGTTCGAATCTGAGACTGTAACACAGCATCGAGTGCTTTCGACATGTGAAAACCTTTCAGCAACTGGTCGTACTTTTTCAAGTGCTCTCTTACTGGCTTACTGACATAGATGTCATCCTGCTTGGGCATGTAGTCTTTGCCTCTTACAAAAACTCTGTATCGTGGGTGCCTCTTCGTTGTGGATTGCAACGGCTTTCTCTCTTCAGGTTTCCGATGTTTATGTTCAACACTCCATTGGTCATTCCTACCACAATCATTTGGTCATCTGGTGCCAAAGCAGGCTCAGTATCGAGGCTGCTTAATCGAAGCTGTGAAACTACTTTGTATTCAATTGTGGCTGTAAACCTTTTCCTTGGCCTGTCTTAAGGAACCCGGAACACCAGCT
Full Trace Sequence: CCGAGTAAACNGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTGGGAACCGAGAGGCAGTATTGGTTTGGGTTCCTCCCATGGACTCTCTTTTTTCGTTGTCATTGTGGCAAACAATGTGTCCATCATTCCCAATATTTTTAAGAGTTCCTCCTGGTAGTTAATTTCTTTTTCTACCACTTCTTGAAGCCTGATAAATTGTTTATGGATTACAGAAGACTGGCCCACTACAGGAGAATAGATATCTATAATGTGCTCTGCCACATTTAATAGAATTGGTAGAAACAGAGGATTTACCAGATGTTTGAGAAGGAAAATGAGCAGGTCACTCAACTCCTTTTCATTTCTTCCAGCAAGAGCATTTTTAAGAGTCCCCCTTCTTTTTAGTTCATTCATGACTGCAACAGTGACTTCAGGCTTTTTCGTTCGAATCTGAGACTGTAACACAGCATCGAGTGCTTTCGACATGTGAAAACCTTTCAGCAACTGGTCGTACTTTTTCAAGTGCTCTCTTACTGGCTTACTGACATAGATGTCATCCTGCTTGGGCATGTAGTCTTTGCCTCTTACAAAAACTCTGTATCGTGGGTGCCTCTTCGTTGTGGATTGCAACGGCTTTCTCTCTTCAGGTTTCCGATGTTTATGTTCAACACTCCATTGGTCATTCCTACCACAATCATTTGGTCATCTGGTGCCAAAGCAGGCTCAGTATCGAGGCTGCTTAATCGAAGCTGTGAAACTACTTTGTATTCAATTGTGGCTGTAAACCTTTTCCTTGGCCTGTCTTAAGGAACCCGGAACACCAGCT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTGGGAACCGAGAGGCAGTA