ORFeome > vbp1 ORF1 – XORFeome v1.0

vbp1 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: vbp1
Gene ID: 980561
Gene Page ID: 980555
ORF Xenbase ID: 17304123

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054252
Original XGC clone length: 579

Human orthology & disease relationships

NCBI Entrez ID: 7411
Ensembl gene IDs: ENSG00000155959
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 193300,226730,300049,300537,304120,305620,309350,311300

Library Location

Plate ID: GDExl11003
Well Location: G07

Sequences - 5ʹ (forward) EST

Accession: JZ839443
dbEST ID: 79657145
Trimmed Sequence: ATGGCGGTGACCAGTGAGGGAGCCGGCGGTGCTGGTTTGAAACGGACTCATTTGGGGATCCCGGAAGCGGGGTTTGTGGAAGATGTGGAGGCATTTATGAAGAAAGCTGGAAATGAGACGGCAGATGCAGTACTCAAGAAATTGGATGAGCAATATCAGAAATATAAATTTATGGAACTTAATCTGACCCAGAAAAAAAGAAGGCTAAAGAATCAGATTCCAGAAATTAAGCAGACCTTAGAAATTTTAAAACACATGCAGAAGAAAAAGGATACTACTGAACCAATGGAAACTAGGTTTATGCTAGCGGATAATCTGTACTGTAAAGCATCGGTGCCACCTACAGACAAAGTCTGTCTGTGGCTGGGGGCCAATGTTATGCTTGAGTACGATATTGATGACGCTCAGGCTTTGCTAGAAAAGAATCTCTCAACTGCTACAAGAAACCTTGACTCTACAGAAGAAGACCTGGACTTCCTTAGGGACCAGTTTACTACGACCGAAGTCAATATGGCTAGAGTTTATAATTGGGATGTAAAAAGAAGAAACAAGGACGACCCTTCAAAAAGCAAAGCTTT
Full Trace Sequence: TCGCGGGCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGGTGACCAGTGAGGGAGCCGGCGGTGCTGGTTTGAAACGGACTCATTTGGGGATCCCGGAAGCGGGGTTTGTGGAAGATGTGGAGGCATTTATGAAGAAAGCTGGAAATGAGACGGCAGATGCAGTACTCAAGAAATTGGATGAGCAATATCAGAAATATAAATTTATGGAACTTAATCTGACCCAGAAAAAAAGAAGGCTAAAGAATCAGATTCCAGAAATTAAGCAGACCTTAGAAATTTTAAAACACATGCAGAAGAAAAAGGATACTACTGAACCAATGGAAACTAGGTTTATGCTAGCGGATAATCTGTACTGTAAAGCATCGGTGCCACCTACAGACAAAGTCTGTCTGTGGCTGGGGGCCAATGTTATGCTTGAGTACGATATTGATGACGCTCAGGCTTTGCTAGAAAAGAATCTCTCAACTGCTACAAGAAACCTTGACTCTACAGAAGAAGACCTGGACTTCCTTAGGGACCAGTTTACTACGACCGAAGTCAATATGGCTAGAGTTTATAATTGGGATGTAAAAAGAAGAAACAAGGACGACCCTTCAAAAAGCAAAGCTTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTTATCATTTGTTGCCACGAACAGGTCACTATCAGTCAAAATAAATCCATAATTGCCCTTCAGCTGATATCCCCCTATGTTGGGGCTATTACCTGGGACCAAAAAAAAATAATAAAAAAAAATAAGGGACAAGTCCAGAAAAAACCCCTAAAAAAATGTAAAAAAACAGAAAAAANCAGANCGGTAAAAAATAGACGTGGGGGATTGGTGGAGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGGTGACCAGTGA

Sequences - 3ʹ (reverse) EST

Accession: JZ839442
dbEST ID: 79657144
Trimmed Sequence: AGCTTTGCTTTTTGAAGGGTCGTCCTTGTTTCTTCTTTTTACATCCCAATTATAAACTCTAGCCATATTGACTTCGGTCGTAGTAAACTGGTCCCTAAGGAAGTCCAGGTCTTCTTCTGTAGAGTCAAGGTTTCTTGTAGCAGTTGAGAGATTCTTTTCTAGCAAAGCCTGAGCGTCATCAATATCGTACTCAAGCATAACATTGGCCCCCAGCCACAGACAGACTTTGTCTGTAGGTGGCACCGATGCTTTACAGTACAGATTATCCGCTAGCATAAACCTAGTTTCCATTGGTTCAGTAGTATCCTTTTTCTTCTGCATGTGTTTTAAAATTTCTAAGGTCTGCTTAATTTCTGGAATCTGATTCTTTAGCCTTCTTTTTTTCTGGGTCAGATTAAGTTCCATAAATTTATATTTCTGATATTGCTCATCCNATTTCTTGAGTACTGCATCTGCCGTCTCATTTCCAGCTTTCTTCATAAATGCCTCCACATCTTCCACAAACCCCGCTTCCCGGATCCCCAAATGAATCCGTTTCAAACCAGCACCCCCGGCTCCCTCACTGGTCACCCCCATGG
Full Trace Sequence: GGCAAAAGGCTTATGACCATGTAATACGACTCACTATAGGGGGAGATCAGCTTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAGCTTTGCTTTTTGAAGGGTCGTCCTTGTTTCTTCTTTTTACATCCCAATTATAAACTCTAGCCATATTGACTTCGGTCGTAGTAAACTGGTCCCTAAGGAAGTCCAGGTCTTCTTCTGTAGAGTCAAGGTTTCTTGTAGCAGTTGAGAGATTCTTTTCTAGCAAAGCCTGAGCGTCATCAATATCGTACTCAAGCATAACATTGGCCCCCAGCCACAGACAGACTTTGTCTGTAGGTGGCACCGATGCTTTACAGTACAGATTATCCGCTAGCATAAACCTAGTTTCCATTGGTTCAGTAGTATCCTTTTTCTTCTGCATGTGTTTTAAAATTTCTAAGGTCTGCTTAATTTCTGGAATCTGATTCTTTAGCCTTCTTTTTTTCTGGGTCAGATTAAGTTCCATAAATTTATATTTCTGATATTGCTCATCCNATTTCTTGAGTACTGCATCTGCCGTCTCATTTCCAGCTTTCTTCATAAATGCCTCCACATCTTCCACAAACCCCGCTTCCCGGATCCCCAAATGAATCCGTTTCAAACCAGCACCCCCGGCTCCCTCACTGGTCACCCCCATGGTGCCCACTTTTTTGTACAAAGTTGGCATTAAAAAAAAACTTTGCTCATCAATTTTTTGCAACGAAGAGGTCGCTATTCAATAAAAAAAAAAAAAAAAAAAAAAAAAAAACAAAAAATAGAAATGGTCCTTCTTTGAAACCACTCCCCTTTTTAACTGGGGT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAGCTTTGCTTTTTGAAGGGTCGT