ORFeome > vdac1 ORF1 – XORFeome v1.0

vdac1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: vdac1
Gene ID: 955070
Gene Page ID: 955062
ORF Xenbase ID: 17304129

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC046577
Original XGC clone length: 852

Human orthology & disease relationships

NCBI Entrez ID: 7416
Ensembl gene IDs: ENSG00000073905
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 101900,123400,124200,137440,228600,236490,500003,551500,601859,603218,607271,607822,609283

Library Location

Plate ID: GDExl11017
Well Location: E01

Sequences - 5ʹ (forward) EST

Accession: JZ824395
dbEST ID: 79642097
Trimmed Sequence: ATGGCCATACCGCCGGCATATGTTGATTTAGGAAAGTCTGCCCGAGATATCTTCACTAAAGGATATGGATTTGGGTTCATCAAACTTGATTTGAAAACAAAATCAGAAAATGGACTGGAATTTACCAGCTCAGGATCAGCAAATGCTGAGACCAGCAAAGTTTCCGGCAACTTGGAAACCAAATACAAGTGGGCGGAATATGGCCTTACTTTCACAGAAAAATGGAATACAGATAACACGTTGGGGACAGAGATCACTGTAGAAGACCAGCTTGCAAAGGGTCTAAAGCTGACATTTGACTCTTCGTTTTCGCCTAACACTGGAAAGAAGAATGCAAAAGTCAAGTCTGCGTATAAGCGAGAGCACCTTAACGTTGGCTGTGACATGGATTTTGATATTGCCGGGCCATCGGTACGTGGAGCTGTGGTGTTTGGCTACGAGGGATGGTTAGCTGGCTACCAAATGACTTTTGAATCCTCAAAGTCCAGAGTCTCCCAAAGCAACTTTGCAGTTGGATACAAAACTGATGAATTCCAGTTGCATACCAATGTGAATGATGGTACAGATTTTGGGTGGTTCTGTATATCANAAGGTTAATGATAAACTGGAAACAGCAATCAACCTTGCATGGACAGCAGGAAACAGCAACACACGCTTCGGAATAGCAGCAAATATCAAATTTGATCTGATGCTTCATTTCAGCTAAAGTGAANTATTCAAGTCTCATTGGGTTTAGGATATACTCAGAACTCTTAAGCCTGGCCATCAATAAAATTTTTCCCCCCTTTGGTTGGAGGGCAGGACAAACAAATGCGGGAGCCCCAAAACGG
Full Trace Sequence: CAATAATGAATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCCATACCGCCGGCATATGTTGATTTAGGAAAGTCTGCCCGAGATATCTTCACTAAAGGATATGGATTTGGGTTCATCAAACTTGATTTGAAAACAAAATCAGAAAATGGACTGGAATTTACCAGCTCAGGATCAGCAAATGCTGAGACCAGCAAAGTTTCCGGCAACTTGGAAACCAAATACAAGTGGGCGGAATATGGCCTTACTTTCACAGAAAAATGGAATACAGATAACACGTTGGGGACAGAGATCACTGTAGAAGACCAGCTTGCAAAGGGTCTAAAGCTGACATTTGACTCTTCGTTTTCGCCTAACACTGGAAAGAAGAATGCAAAAGTCAAGTCTGCGTATAAGCGAGAGCACCTTAACGTTGGCTGTGACATGGATTTTGATATTGCCGGGCCATCGGTACGTGGAGCTGTGGTGTTTGGCTACGAGGGATGGTTAGCTGGCTACCAAATGACTTTTGAATCCTCAAAGTCCAGAGTCTCCCAAAGCAACTTTGCAGTTGGATACAAAACTGATGAATTCCAGTTGCATACCAATGTGAATGATGGTACAGATTTTGGGTGGTTCTGTATATCANAAGGTTAATGATAAACTGGAAACAGCAATCAACCTTGCATGGACAGCAGGAAACAGCAACACACGCTTCGGAATAGCAGCAAATATCAAATTTGATCTGATGCTTCATTTCAGCTAAAGTGAANTATTCAAGTCTCATTGGGTTTAGGATATACTCAGAACTCTTAAGCCTGGCCATCAATAAAATTTTTCCCCCCTTTGGTTGGAGGGCAGGACAAACAAATGCGGGAGCCCCAAAACGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCCATACCGCCGGCATATGTT

Sequences - 3ʹ (reverse) EST

Accession: JZ829752
dbEST ID: 79647454
Trimmed Sequence: TGCTTCAAATTCCAGTCCCAGACCCAGTTTGTGGCCTCCGGCATTGATGTTCTTGCCATCAACCAACGTGGATAATGTTAATTTGATGCCAGGCTTAAGAGTCTGAGTATATCCTAAACCAATGAGACTTGAATTATTCACTTTAGCTGAAAATGAAGCATCAGAATCAATTTGATATTTGGCTGCTATTCCGAAGCGTGTGTTGCTGTTTCCTGCTGTCCATGCAAGGTTGATTGCTGTTTCCAGTTTATCATTAACCTTTTGATATACAGAACCACCAAAATCTGTACCATCATTCACATTGGTATGCAACTGGAATTCATCAGTTTTGTATCCAACTGCAAAGTTGCTTTGGGAGACTCTGGACTTTGAGGATTCAAAAGTCATTTGGTAGCCAGCTAACCATCCCTCGTAGCCAAACACCACAGCTCCACGTACCGATGGCCCGGCAATATCAAAATCCATGTCACAGCCAACGTTAAGGTGCTCTCGCTTATACGCAGACTTGACTTTTGCATTCTTCTTTCCAGTGTTAGGCGAAAACGAAGAGTCAAATGTCAGCTTTAGACCCTTTGCAAGCTGGTCTTCTACAGTGATCTCTGTCCCCAACGTGTTATCTGTATTCCATTTTTCTGTGAAAGTAAGGCCATATTCCGCCCACCTTGTATTTGGTTTCAAGTTTGCCGGAAAACTTTGCCGGTCTCAGCAATTTGCTGATTCCTGGAGCTGGTAAAATCTCCGTTCCCATTTTTCCGGAATTTTGTTTTTT
Full Trace Sequence: GGACGGGTAGCAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATGCTTCAAATTCCAGTCCCAGACCCAGTTTGTGGCCTCCGGCATTGATGTTCTTGCCATCAACCAACGTGGATAATGTTAATTTGATGCCAGGCTTAAGAGTCTGAGTATATCCTAAACCAATGAGACTTGAATTATTCACTTTAGCTGAAAATGAAGCATCAGAATCAATTTGATATTTGGCTGCTATTCCGAAGCGTGTGTTGCTGTTTCCTGCTGTCCATGCAAGGTTGATTGCTGTTTCCAGTTTATCATTAACCTTTTGATATACAGAACCACCAAAATCTGTACCATCATTCACATTGGTATGCAACTGGAATTCATCAGTTTTGTATCCAACTGCAAAGTTGCTTTGGGAGACTCTGGACTTTGAGGATTCAAAAGTCATTTGGTAGCCAGCTAACCATCCCTCGTAGCCAAACACCACAGCTCCACGTACCGATGGCCCGGCAATATCAAAATCCATGTCACAGCCAACGTTAAGGTGCTCTCGCTTATACGCAGACTTGACTTTTGCATTCTTCTTTCCAGTGTTAGGCGAAAACGAAGAGTCAAATGTCAGCTTTAGACCCTTTGCAAGCTGGTCTTCTACAGTGATCTCTGTCCCCAACGTGTTATCTGTATTCCATTTTTCTGTGAAAGTAAGGCCATATTCCGCCCACCTTGTATTTGGTTTCAAGTTTGCCGGAAAACTTTGCCGGTCTCAGCAATTTGCTGATTCCTGGAGCTGGTAAAATCTCCGTTCCCATTTTTCCGGAATTTTGTTTTTT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATGCTTCAAATTCCAGTCCC