ORFeome > vegt ORF1 – XORFeome v1.0

vegt ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: vegt
Gene ID: 1033836
Gene Page ID: 1033828
ORF Xenbase ID: 17304153

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC070708
Original XGC clone length: 1368

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11053
Well Location: A11

Sequences - 5ʹ (forward) EST

Accession: JZ831966
dbEST ID: 79649668
Trimmed Sequence: ATGAGAAACTGCTGTCGGGAACGTGGATTCTCTGTGGGGCGTCTGGAACCAGAGACTTCCTTTAGCTGTGCATCAGATGTAAAGTCTTCCCCAGACATGGACAGTGTCTCCAGCCAAGACTCCCTCTACCTGCCCAACTCTATTGGTGCCTCCCTGGAAGACCAAAATCTCTGGACCCAGTTCCACCAGGAGGGGACAGAGATGATCATCACTAAGTCTGGAAGGAGGATGTTTCCTCAGTGTAAGATCCGGCTCTTTGGTCTTCATCCTTATACCAAGTACATGCTGCTGGTGGACTTTGTTCCTCTGGACAACTTCAGGTATAAGTGGAATAAGAACCAGTGGGAAGCAGCAGGCAAAGCAGAACCTCACCCACCCTGCAGGACGTATGTCCACCCAGACTCGCCTGCCTCTGGTGCCCACTGGATGAAGGATCCAATCTGCTTCCAGAAGCTCAAACTCACCAATAACACACTGGATCAACAAGGCCATATTATCTTGCATTCAATGCATCGCTACAAGCCCAGGTTCCATGTTGTTCAGTCTGATGACATGTACAATTCTCCATGGGGATTGGTGCAGGTGTTTAGCTTCCCAGAGACTGAGTTCACTGCAGTAACTGCCTACCAAAATGAAAAGATTACTAAACTAAAAATTAATCACAACCCATTTGGCTAAAGGATTCCGGGAGCAAGAAAGGAATCCCAAAAGGGATGATGTCTTAAAAACTCCTTACACAAATTCCCCATAAAAACCCAAAAAAAGAAGAAAGTGGGGAAGAACGTCCCCCAAGGCCTGAAATTTTTTAA
Full Trace Sequence: TCTATAGCTCGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAGAAACTGCTGTCGGGAACGTGGATTCTCTGTGGGGCGTCTGGAACCAGAGACTTCCTTTAGCTGTGCATCAGATGTAAAGTCTTCCCCAGACATGGACAGTGTCTCCAGCCAAGACTCCCTCTACCTGCCCAACTCTATTGGTGCCTCCCTGGAAGACCAAAATCTCTGGACCCAGTTCCACCAGGAGGGGACAGAGATGATCATCACTAAGTCTGGAAGGAGGATGTTTCCTCAGTGTAAGATCCGGCTCTTTGGTCTTCATCCTTATACCAAGTACATGCTGCTGGTGGACTTTGTTCCTCTGGACAACTTCAGGTATAAGTGGAATAAGAACCAGTGGGAAGCAGCAGGCAAAGCAGAACCTCACCCACCCTGCAGGACGTATGTCCACCCAGACTCGCCTGCCTCTGGTGCCCACTGGATGAAGGATCCAATCTGCTTCCAGAAGCTCAAACTCACCAATAACACACTGGATCAACAAGGCCATATTATCTTGCATTCAATGCATCGCTACAAGCCCAGGTTCCATGTTGTTCAGTCTGATGACATGTACAATTCTCCATGGGGATTGGTGCAGGTGTTTAGCTTCCCAGAGACTGAGTTCACTGCAGTAACTGCCTACCAAAATGAAAAGATTACTAAACTAAAAATTAATCACAACCCATTTGGCTAAAGGATTCCGGGAGCAAGAAAGGAATCCCAAAAGGGATGATGTCTTAAAAACTCCTTACACAAATTCCCCATAAAAACCCAAAAAAAGAAGAAAGTGGGGAAGAACGTCCCCCAAGGCCTGAAATTTTTTAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGAAACTGCTGTCGGGAA

Sequences - 3ʹ (reverse) EST

Accession: JZ831967
dbEST ID: 79649669
Trimmed Sequence: CCAGCAGCTGTAGGGGAAGAGAGAATATTGGCTCCAGTCCGACATCCCACTATGTGGGTGAGCTACTGCTCCTTGTGCACTTAAGTCTGTTGGGTATGCAGTATAGCTGACAGGCTGATATGGACCTTGAGCTGGAACCATCCACTGCTCTGTTCCATAAGGGCTGTATATGGCACCCCGGAGGGGCTGTTTCATTGGGGTTTCCATGGAAAAGTTCATAGAACATGTGCGTTCCTGAGCAGAATTCTGTGTTGGAATGACATGAAGCACTGCTAAAGAATCTGGATCAGAATCCGGCACTGTAGCAACATCAGGGGTAAGACGTCTGCTAGAGGGCTCTCCCAAATCATATGGTGAGGAAAGATGTTGGGAACTCCTTCGATATTGGCTCTTGATATAGAAGTTCGAGGAAGATGTGGGGACCTGCTGCTCCTGATTGACACCCTCAGACTCAGGGGAAGTGGGGTGTCAAGCCTTGGTTAGCCTCATGATCTGAAACCCAGTTCTGGTAAACTCCTGCTGGATCCATAATGGATTCCTCCTTAATGCGTGTAGCCTTGGGGAAATCTGAAATATCAGCCTCGGGACTGTCCTCCCACTTCTTCCCTCTCTGGGCTCTACTGGGACTTTGTTGTAGAGTCTTAAGACATCATCCCTCTTGTGACTCCTTTTCTGCTCCCGGATCCTTTAACCAAAGGGGTGGGAATTAATTTTTTGTTAATTATCTTTTTATTTTGGGGTGGGGTTTTCGGGCATGGAAACCTCTT
Full Trace Sequence: CGGGCAAGCAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACCAGCAGCTGTAGGGGAAGAGAGAATATTGGCTCCAGTCCGACATCCCACTATGTGGGTGAGCTACTGCTCCTTGTGCACTTAAGTCTGTTGGGTATGCAGTATAGCTGACAGGCTGATATGGACCTTGAGCTGGAACCATCCACTGCTCTGTTCCATAAGGGCTGTATATGGCACCCCGGAGGGGCTGTTTCATTGGGGTTTCCATGGAAAAGTTCATAGAACATGTGCGTTCCTGAGCAGAATTCTGTGTTGGAATGACATGAAGCACTGCTAAAGAATCTGGATCAGAATCCGGCACTGTAGCAACATCAGGGGTAAGACGTCTGCTAGAGGGCTCTCCCAAATCATATGGTGAGGAAAGATGTTGGGAACTCCTTCGATATTGGCTCTTGATATAGAAGTTCGAGGAAGATGTGGGGACCTGCTGCTCCTGATTGACACCCTCAGACTCAGGGGAAGTGGGGTGTCAAGCCTTGGTTAGCCTCATGATCTGAAACCCAGTTCTGGTAAACTCCTGCTGGATCCATAATGGATTCCTCCTTAATGCGTGTAGCCTTGGGGAAATCTGAAATATCAGCCTCGGGACTGTCCTCCCACTTCTTCCCTCTCTGGGCTCTACTGGGACTTTGTTGTAGAGTCTTAAGACATCATCCCTCTTGTGACTCCTTTTCTGCTCCCGGATCCTTTAACCAAAGGGGTGGGAATTAATTTTTTGTTAATTATCTTTTTATTTTGGGGTGGGGTTTTCGGGCATGGAAACCTCTT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACCAGCAGCTGTAGGGGA