ORFeome > vgll4 ORF1 – XORFeome v1.0

vgll4 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: vgll4
Gene ID: 997549
Gene Page ID: 997543
ORF Xenbase ID: 17304183

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123267
Original XGC clone length: 882

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11092
Well Location: D02

Sequences - 5ʹ (forward) EST

Accession: JZ838773
dbEST ID: 79656475
Trimmed Sequence: ATGCTCGCTCTGACCATGGACCTGCTCAACTACCAGTATCTGCACAACATGAACAACAACAACATCGCTATTCTCTGCTATGAAGGGGAAGCAGCATTACGGAGTGACCCCAGGGTGCAGCCGCTCCCCATGTCCTCTGCTCTATCCAATCACCGGACAGCGCCTCCCCCCATCAGCCCCAGCAAACGGAGGTTCAGCATGGACCAAGGAGACGACGAACTAGAGTGTGACAACGACCATGTCTCCGAAATGAGTCGGATGTTTGCTCCGCACATAACCAAGAGCCTTAACGGCGATTACCGGAAAGAGCACAGAGACCGGAGCCGGAGCCCTATAGAAAGAGCAGCAGCGCCGACCATGAGTCTCCACGCCAGCAATTTGTATGGTATCCCACCCCTGGCGGTGGATCAACCTCTGGCACTTACCAAAAACATACAGAATGCTTCAGAAAACATGGAAATTTTGCCCCCCATGAAAGGATGCACAGAACCCAACCTTCTGTGATTACGTGTGCGGGCAGCAGGTGAAAGCAACGTAAGTCGATCGTGACGACGCCACAGACACCCCAGGAGGTATAGGCACTGCGCTGTGAGACGAGCAATGTTCCAATGGCAAATCTAAGACATAGAAGTACCAGGGGTGCGTCTTATGTGGAGGAAAGATATACTGTGGAAATTATTGACTAATAGAGAAAAGAAAAAACAGGGTGATCATGGACCTAGTGATGATATCTTGTAAATTTAAATAACTCAGATAGTCTCCATTCTTAGAATGTGCACCTATGAAAGTAATACACAAAGGAAACAGGAAATTTGATAACTGTGAGAAGGAGAGGGGGGTCA
Full Trace Sequence: TCGGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAGTGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCTCGCTCTGACCATGGACCTGCTCAACTACCAGTATCTGCACAACATGAACAACAACAACATCGCTATTCTCTGCTATGAAGGGGAAGCAGCATTACGGAGTGACCCCAGGGTGCAGCCGCTCCCCATGTCCTCTGCTCTATCCAATCACCGGACAGCGCCTCCCCCCATCAGCCCCAGCAAACGGAGGTTCAGCATGGACCAAGGAGACGACGAACTAGAGTGTGACAACGACCATGTCTCCGAAATGAGTCGGATGTTTGCTCCGCACATAACCAAGAGCCTTAACGGCGATTACCGGAAAGAGCACAGAGACCGGAGCCGGAGCCCTATAGAAAGAGCAGCAGCGCCGACCATGAGTCTCCACGCCAGCAATTTGTATGGTATCCCACCCCTGGCGGTGGATCAACCTCTGGCACTTACCAAAAACATACAGAATGCTTCAGAAAACATGGAAATTTTGCCCCCCATGAAAGGATGCACAGAACCCAACCTTCTGTGATTACGTGTGCGGGCAGCAGGTGAAAGCAACGTAAGTCGATCGTGACGACGCCACAGACACCCCAGGAGGTATAGGCACTGCGCTGTGAGACGAGCAATGTTCCAATGGCAAATCTAAGACATAGAAGTACCAGGGGTGCGTCTTATGTGGAGGAAAGATATACTGTGGAAATTATTGACTAATAGAGAAAAGAAAAAACAGGGTGATCATGGACCTAGTGATGATATCTTGTAAATTTAAATAACTCAGATAGTCTCCATTCTTAGAATGTGCACCTATGAAAGTAATACACAAAGGAAACAGGAAATTTGATAACTGTGAGAAGGAGAGGGGGGTCA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCTCGCTCTGACCATGGACCT

Sequences - 3ʹ (reverse) EST

Accession: JZ838772
dbEST ID: 79656474
Trimmed Sequence: GGAGAGGACGGATGGGGAGTGATTGTGGTTCATCATATGAGCCGAAGGGGGCGATTGACCTCTTCGTGAGGCAGATTCGGGGCTACTAGGCCCACCATCCTTGGCAGCTTTAATCTGGAGCCAGGTATCTCCAAGGGCCTTGGCAAAATGGTCATCAACCGAACCGGTGATAGACACAGAATTGGCAACGGGCTCCGGTTCCTTGTAGTTCTTGCCGAGACTTCTGCGAAAGTGCTCTTCCACCACAGGGTCACAGGCAGTCGTAGTGTTCGATGGCCGTCGGAAATTGCCTGGCGCAGCAGAGGCACAACCACTGTGGGTGACTGTGGGGCAGTGAGACAGACTGCAGTTGCGGTTACTTGCCGGCGCACACGTAATCACAGAAGGTCGGTTCTGTTGCCGTTCCATGGGGGGCACGATTCCCATGCTTCGTGAAGCATCCATGCTGTTTTTGGTAAGTGCGCCAGGCTGAGCCACCGCCAGGGGTGGGATACCATACAAATGGGCTGGCGTGGGAGACTCATGGTCGGCGCTGGTGCTCTTTCTATAATGCTCCCGGCTCCGGTCTCTGTGCCCCTTCTGGTAATCCGCGGTTAAAGGCTCTGGGTGATTTGGGGAAGCGAAACATGCGAATCATTTTTGAAAAACTTGGTGCGTTTGTCGCTCTCTAGTTTCATCTTCTTCCTTGGGGGCATGGCTGAAGGGCCCGTTGTTCCTATTCCCCTGGGTGGGGGGGGGGGGCCCGGGGCGCGGGGTGAGGTGGGAG
Full Trace Sequence: AAACAGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGGAGAGGACGGATGGGGAGTGATTGTGGTTCATCATATGAGCCGAAGGGGGCGATTGACCTCTTCGTGAGGCAGATTCGGGGCTACTAGGCCCACCATCCTTGGCAGCTTTAATCTGGAGCCAGGTATCTCCAAGGGCCTTGGCAAAATGGTCATCAACCGAACCGGTGATAGACACAGAATTGGCAACGGGCTCCGGTTCCTTGTAGTTCTTGCCGAGACTTCTGCGAAAGTGCTCTTCCACCACAGGGTCACAGGCAGTCGTAGTGTTCGATGGCCGTCGGAAATTGCCTGGCGCAGCAGAGGCACAACCACTGTGGGTGACTGTGGGGCAGTGAGACAGACTGCAGTTGCGGTTACTTGCCGGCGCACACGTAATCACAGAAGGTCGGTTCTGTTGCCGTTCCATGGGGGGCACGATTCCCATGCTTCGTGAAGCATCCATGCTGTTTTTGGTAAGTGCGCCAGGCTGAGCCACCGCCAGGGGTGGGATACCATACAAATGGGCTGGCGTGGGAGACTCATGGTCGGCGCTGGTGCTCTTTCTATAATGCTCCCGGCTCCGGTCTCTGTGCCCCTTCTGGTAATCCGCGGTTAAAGGCTCTGGGTGATTTGGGGAAGCGAAACATGCGAATCATTTTTGAAAAACTTGGTGCGTTTGTCGCTCTCTAGTTTCATCTTCTTCCTTGGGGGCATGGCTGAAGGGCCCGTTGTTCCTATTCCCCTGGGTGGGGGGGGGGGGCCCGGGGCGCGGGGTGAGGTGGGAG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGAGAGGACGGATGGGGA