ORFeome > vim ORF1 – XORFeome v1.0

vim ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: vim
Gene ID: 6255792
Gene Page ID: 493023
ORF Xenbase ID: 17304195

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054161
Original XGC clone length: 1392

Human orthology & disease relationships

NCBI Entrez ID: 7431
Ensembl gene IDs: ENSG00000026025
Directly associated (OMIM) disease MIM numbers: 116300
Indirectly associated (Lage, et al.) disease MIM numbers: 102900,115200,118400,123320,124900,125800,131950,161800,164200,186100,192600,209300,215600,226670,261100,266200,301000,304400,313400,313900,600652,601419,603278,603622,604765,605249,606072,607801,608751,608758

Library Location

Plate ID: GDExl11001
Well Location: E08

Sequences - 5ʹ (forward) EST

Accession: JZ839190
dbEST ID: 79656892
Trimmed Sequence: ATGGCAACAACCAAGTCATCTTACAGAAGGATTTTCGGGGGGAACCCTAGGTCGAGCTCATCTGGAAGTCGCTATGTGACTTCCAGCTCTCGGTACTCCCTGGGCAGTTCCATGCGCCCGGGCACCAGCAGCAGCAGAATGGTCTATTCCACCTCTGCCTCCCCCGCCGTCTTCAAGTCGTCCTCGGTCAGACTGAGGAGCAGCCTCCCCCCGGCCAGAATGTCCGACTCCGTGGACTTCACCCTGGCAGATGCCGTCAACCTCGAGTTTAAAGCCAACAGGACCTACGAGAAGGCGGAGATGATCGAACTCAACGACAGGTTCGCCAACTTCATCGACAAGGTGCGATTCCTGGAGCAGCAGAACAAGATCCTGGTGGCGGAGCTGGAGCAGCTGAAAGGGAAGGGCACCTCGCGGATAGGGGATCTCTATGAGGAGGAGATGAGGGAGATCCGCCGACAATTGGATCAGGCGATCAACGAGAAAGCCCGAGTAGAAGTGGACAGAGACAACCTGGGCGACGACCTCCAGCGACTGAGAGAAAAGCTTCAAGATGAAATGATCCAAAGAGAAGAAGCAGAAGGCAACCTGCAGTCATTCAGACAGGATGTGGATAATGCCTCTCTGGCACGCATTGACTTGGAAAAGGAGGGTTGATTCCTTACAAAAAAAAAATGGTTTTCCTGAAAAAACTCCCTGAAGAAGGAAATCCGAAAAACTTTCGCCTTCCAATTCCAGGAATTCACATATTCCCGGTTTGACATGGAAGGGTGTTCAAAAGCCGGGAACCTCCAGGGCCGGCCCCCTAACTTGTGAGTGT
Full Trace Sequence: CTCGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCAACAACCAAGTCATCTTACAGAAGGATTTTCGGGGGGAACCCTAGGTCGAGCTCATCTGGAAGTCGCTATGTGACTTCCAGCTCTCGGTACTCCCTGGGCAGTTCCATGCGCCCGGGCACCAGCAGCAGCAGAATGGTCTATTCCACCTCTGCCTCCCCCGCCGTCTTCAAGTCGTCCTCGGTCAGACTGAGGAGCAGCCTCCCCCCGGCCAGAATGTCCGACTCCGTGGACTTCACCCTGGCAGATGCCGTCAACCTCGAGTTTAAAGCCAACAGGACCTACGAGAAGGCGGAGATGATCGAACTCAACGACAGGTTCGCCAACTTCATCGACAAGGTGCGATTCCTGGAGCAGCAGAACAAGATCCTGGTGGCGGAGCTGGAGCAGCTGAAAGGGAAGGGCACCTCGCGGATAGGGGATCTCTATGAGGAGGAGATGAGGGAGATCCGCCGACAATTGGATCAGGCGATCAACGAGAAAGCCCGAGTAGAAGTGGACAGAGACAACCTGGGCGACGACCTCCAGCGACTGAGAGAAAAGCTTCAAGATGAAATGATCCAAAGAGAAGAAGCAGAAGGCAACCTGCAGTCATTCAGACAGGATGTGGATAATGCCTCTCTGGCACGCATTGACTTGGAAAAGGAGGGTTGATTCCTTACAAAAAAAAAATGGTTTTCCTGAAAAAACTCCCTGAAGAAGGAAATCCGAAAAACTTTCGCCTTCCAATTCCAGGAATTCACATATTCCCGGTTTGACATGGAAGGGTGTTCAAAAGCCGGGAACCTCCAGGGCCGGCCCCCTAACTTGTGAGTGT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCAACAACCAAGTCATC

Sequences - 3ʹ (reverse) EST

Accession: JZ839189
dbEST ID: 79656891
Trimmed Sequence: CTCCAGGTCCAGGTCCAGGTCATCGTGGTGCTGGGAGCTTTCATTAATAACCTGTCCATCTCTTGTCTCCACAGTCTTGATGAGCAGAGTGCGTTTGGAATGAGTGTCCACTGGGTGAGAATCGCGGTTGGTTTCTCTCAGGCTCATTGTAGAAAAGGAATGTACAGGAATGGTAATTCTGCTCTCCTCTCCCTCCAGGAGTTTCCTGTAAGTAGCAATCTCAATATCAAGAGCCATCTTAACATTGAGCAGATCCTGGTACTCTCTCAGGTGCCGAGACATCTCCTCCTTCATGTTCTGGATTTCCTCTTGCAGGCGTTGAATAGTGTCCTGATAATTAGCAGCTTCAAGGGCAAAGTTCTCCTCCATTTCTCGCATTTGGCGTTCGTAAGACTCGTTAGATCCTTTCATTGCATCAATCTCGCAGGTTAGAGTCTGGATCTGTCTGCGGTAGTCATTGGTATCCTGCTTAGCCTGACGCAGAGCTTCATTGTTGCGATTAGCAGCTTCCGACAGGTCAGCAAACTTAGACTTGTACCAGTCTTCGGCATCTGCAAGATTTTTAGAAGCCACATTCTCATACTGCTGGCGGACATCACGTAGGGCAGCAGTGAGATCCGGTTTCGACACATCCATGTCAACCTGGATATGTGACTCCTGAATTTTAAAGCTGAAGTTCTCGGAATTCCTCATTCATGGAAATTTTTTTCGGGAAAAACATTCTCTTTCTTGTAAAGGAACTCAACCTTTTCCTCCTCCCAAGTC
Full Trace Sequence: CGGGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTNGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTCCAGGTCCAGGTCCAGGTCATCGTGGTGCTGGGAGCTTTCATTAATAACCTGTCCATCTCTTGTCTCCACAGTCTTGATGAGCAGAGTGCGTTTGGAATGAGTGTCCACTGGGTGAGAATCGCGGTTGGTTTCTCTCAGGCTCATTGTAGAAAAGGAATGTACAGGAATGGTAATTCTGCTCTCCTCTCCCTCCAGGAGTTTCCTGTAAGTAGCAATCTCAATATCAAGAGCCATCTTAACATTGAGCAGATCCTGGTACTCTCTCAGGTGCCGAGACATCTCCTCCTTCATGTTCTGGATTTCCTCTTGCAGGCGTTGAATAGTGTCCTGATAATTAGCAGCTTCAAGGGCAAAGTTCTCCTCCATTTCTCGCATTTGGCGTTCGTAAGACTCGTTAGATCCTTTCATTGCATCAATCTCGCAGGTTAGAGTCTGGATCTGTCTGCGGTAGTCATTGGTATCCTGCTTAGCCTGACGCAGAGCTTCATTGTTGCGATTAGCAGCTTCCGACAGGTCAGCAAACTTAGACTTGTACCAGTCTTCGGCATCTGCAAGATTTTTAGAAGCCACATTCTCATACTGCTGGCGGACATCACGTAGGGCAGCAGTGAGATCCGGTTTCGACACATCCATGTCAACCTGGATATGTGACTCCTGAATTTTAAAGCTGAAGTTCTCGGAATTCCTCATTCATGGAAATTTTTTTCGGGAAAAACATTCTCTTTCTTGTAAAGGAACTCAACCTTTTCCTCCTCCCAAGTC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTCCAGGTCCAGGTCCA