ORFeome > vip ORF1 – XORFeome v1.0

vip ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: vip
Gene ID: 988258
Gene Page ID: 988256
ORF Xenbase ID: 17304237

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC043792
Original XGC clone length: 609

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11012
Well Location: A03

Sequences - 5ʹ (forward) EST

Accession: JZ823988
dbEST ID: 79641690
Trimmed Sequence: ATGGAACACAGAAGCATCTTTCACCTTCTGGTATCTTTTACTCTCTTCAATGTTTTCTGCTTAAGAGCCCGGGCATTGCCTCCCATGGGGACCTATTCAAATCCCAGGCTGGGAAATCGGTTACCATTTGAGGGAGCAAGTGAACCTGATCAGACTCAGGGATCATTAAAACCAGACACAGACATGCTTCAAGACACACTACCAGAAAATGACAATTTCTTTATGGATATGTCCAGAGCAGTTGGCAGAACATCAAGACACGCTGATGGACTCTTCACTAGTGGATACAGCAAGCTTTTGGGTCAGCTTTCTGCCAGAAGATATCTAGAGTCTTTGATTGGAAAAAGAGTAAACAACAATGTGGTAGAAGATCAGGTGCCTGTAAAGCGCCACTCTGATGCTGTGTTCACTGATAACTACAGTCGATTTAGGAAGCAAATGGCTGTAAAGAAATACTTGAATTCTGTCTTGACTGGAAAGAGAAGTCAAGAAGATATTGATCCCGCGAGTCTTCGAGAAAATGCAGATCTAAGTCAACCACCATTTTCAGACAACTATGATGATGCCACGCTGAATGAAATCCTAAACCACCTCCAATTGAACCTTTT
Full Trace Sequence: CAATATCGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAACACAGAAGCATCTTTCACCTTCTGGTATCTTTTACTCTCTTCAATGTTTTCTGCTTAAGAGCCCGGGCATTGCCTCCCATGGGGACCTATTCAAATCCCAGGCTGGGAAATCGGTTACCATTTGAGGGAGCAAGTGAACCTGATCAGACTCAGGGATCATTAAAACCAGACACAGACATGCTTCAAGACACACTACCAGAAAATGACAATTTCTTTATGGATATGTCCAGAGCAGTTGGCAGAACATCAAGACACGCTGATGGACTCTTCACTAGTGGATACAGCAAGCTTTTGGGTCAGCTTTCTGCCAGAAGATATCTAGAGTCTTTGATTGGAAAAAGAGTAAACAACAATGTGGTAGAAGATCAGGTGCCTGTAAAGCGCCACTCTGATGCTGTGTTCACTGATAACTACAGTCGATTTAGGAAGCAAATGGCTGTAAAGAAATACTTGAATTCTGTCTTGACTGGAAAGAGAAGTCAAGAAGATATTGATCCCGCGAGTCTTCGAGAAAATGCAGATCTAAGTCAACCACCATTTTCAGACAACTATGATGATGCCACGCTGAATGAAATCCTAAACCACCTCCAATTGAACCTTTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAAGCATTGCTTATCATTTGTTGCAACGAACAGGTCACTATCAGTCAAATAAAATCCATATTTGCCAATCCAGCTGATATCCCCTATAAATGAGTCGTATACATGGGGCAAAGCTGTTCCTGCACTCGCAGCCCAAAACCCCACCCCCCCAAAAACACAAAAACAAAAAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAACACAGAAGCATCTTTCAC

Sequences - 3ʹ (reverse) EST

Accession: JZ829296
dbEST ID: 79646998
Trimmed Sequence: AAGGTTCAATTGGAGGTGGTTTAGGATTTCATTCAGCGTGGCATCATCATAGTTGTCTGAAAATGGTGGTTGACTTAGATCTGCATTTTCTCGAAGACTCGCGGGATCAATATCTTCTTGACTTCTCTTTCCAGTCAAGACAGAATTCAAGTATTTCTTTACAGCCATTTGCTTCCTAAATCGACTGTAGTTATCAGTGAACACAGCATCAGAGTGGCGCTTTACAGGCACCTGATCTTCTACCACATTGTTGTTTACTCTTTTTCCAATCAAAGACTCTAGATATCTTCTGGCAGAAAGCTGACCCAAAAGCTTGCTGTATCCACTAGTGAAGAGTCCATCAGCGTGTCTTGATGTTCTGCCAACTGCTCTGGACATATCCATAAAGAAATTGTCATTTTCTGGTAGTGTGTCTTGAAGCATGTCTGTGTCTGGTTTTAATGATCCCTGAGTCTGATCAGGTTCACTTGCTCCCTCAAATGGTAACCGATTTCCCAGCCTGGGATTTGAATAGGTCCCCATGGGAGGCAATGCCCGGGCTCTTAAGCAGAAAACATTGAAAAGAGTAAAAGATACCAGAAGGTGAAAGATGCTTCTGTGTTCCATGGG
Full Trace Sequence: GGGCAGGGAACAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCNAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAAGGTTCAATTGGAGGTGGTTTAGGATTTCATTCAGCGTGGCATCATCATAGTTGTCTGAAAATGGTGGTTGACTTAGATCTGCATTTTCTCGAAGACTCGCGGGATCAATATCTTCTTGACTTCTCTTTCCAGTCAAGACAGAATTCAAGTATTTCTTTACAGCCATTTGCTTCCTAAATCGACTGTAGTTATCAGTGAACACAGCATCAGAGTGGCGCTTTACAGGCACCTGATCTTCTACCACATTGTTGTTTACTCTTTTTCCAATCAAAGACTCTAGATATCTTCTGGCAGAAAGCTGACCCAAAAGCTTGCTGTATCCACTAGTGAAGAGTCCATCAGCGTGTCTTGATGTTCTGCCAACTGCTCTGGACATATCCATAAAGAAATTGTCATTTTCTGGTAGTGTGTCTTGAAGCATGTCTGTGTCTGGTTTTAATGATCCCTGAGTCTGATCAGGTTCACTTGCTCCCTCAAATGGTAACCGATTTCCCAGCCTGGGATTTGAATAGGTCCCCATGGGAGGCAATGCCCGGGCTCTTAAGCAGAAAACATTGAAAAGAGTAAAAGATACCAGAAGGTGAAAGATGCTTCTGTGTTCCATGGGTGCCAACTTTTTTGTACAAGTTTGGCATTTATAAAAAACCTTTGCTCATCATTTGTTGCAACGAAAAGGGTCACTATAGTTAAAAAAAATTCATAATTGGGGGCCCGAAGCTTAAACTGGGCGTTCTTTCAAAACCCCCCCCTGTAAACGGGGGGAGAATTN
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAAGGTTCAATTGGAGGTGGT