ORFeome > vrk1 ORF1 – XORFeome v1.0

vrk1 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: vrk1
Gene ID: 1003802
Gene Page ID: 1003795
ORF Xenbase ID: 17304411

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054213
Original XGC clone length: 435

Human orthology & disease relationships

NCBI Entrez ID: 7443
Ensembl gene IDs: ENSG00000100749
Directly associated (OMIM) disease MIM numbers: 607596
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11002
Well Location: A07

Sequences - 5ʹ (forward) EST

Accession: JZ839345
dbEST ID: 79657047
Trimmed Sequence: ATGCCACCCAAGAAAGCCACAGGAGCCAGAAAGGCCCCAGCTAAAAGAAAGCTGGCTGAAGAGTTTCCTGCAGGAGAGGTGCTAACAGATTCAGCAAAAAAACAATGGAAATTGGGGTTACCAATTGGACAGGGTGGATTTGGTCGTCTTTATCTTGCGGATGAAAATTCTTCTAGAATTATAGGACCAGATGCTCCATATGTCATTAAAGTAGAACCAAGTGAAAATGGACCACTTTTCTCTGAACTTAAATTCTATATGCGTGCTGCAAAACCTGACCAGATTCAGAAATGGAGCAGCTCTCATAAGATGAAATACTTGGGTGTGCCCAGATACTGGGGCTCTGGTCTGCATTCCAAAAATGGAAACAGTTACAGATTTTTGAAAACAAAGGAAAAATCTTGGCACGTAAAACGGTTTTACAGTTGGGTTTT
Full Trace Sequence: TTCGAGGGCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCCACCCAAGAAAGCCACAGGAGCCAGAAAGGCCCCAGCTAAAAGAAAGCTGGCTGAAGAGTTTCCTGCAGGAGAGGTGCTAACAGATTCAGCAAAAAAACAATGGAAATTGGGGTTACCAATTGGACAGGGTGGATTTGGTCGTCTTTATCTTGCGGATGAAAATTCTTCTAGAATTATAGGACCAGATGCTCCATATGTCATTAAAGTAGAACCAAGTGAAAATGGACCACTTTTCTCTGAACTTAAATTCTATATGCGTGCTGCAAAACCTGACCAGATTCAGAAATGGAGCAGCTCTCATAAGATGAAATACTTGGGTGTGCCCAGATACTGGGGCTCTGGTCTGCATTCCAAAAATGGAAACAGTTACAGATTTTTGAAAACAAAGGAAAAATCTTGGCACGTAAAACGGTTTTACAGTTGGGTTTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCCTGGCAGCAAAAAAAAAAAGAAACAAATCTCTTGAAGTTAAAACGACNGCAAGGCCCTGGGTCCTTNNCTTTGCTCCTTCTGCTCCCCGCCTGGAAAAAAAAAAAAAAAAAAAGAGAAAAGTAAAAGAAAACCACCGCGCGACCTACCCGAACCTCTCCGGCGCGCAGGGGGTGGTGTTTTGTGGGGGTACATTCGGCGCGGCCGCGGGAGCGTGGTGATGGGAGCNNGACACGCTGGAAGGGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCCACCCAAGAAAGCCACAGGA

Sequences - 3ʹ (reverse) EST

Accession: JZ839344
dbEST ID: 79657046
Trimmed Sequence: AACCCAACTGTAAAACCGTTTTACGTGCCAAGATTTTTCCTTTGTTTTCAAAAATCTGTAACTGTTTCCATTTTTGGAATGCAGACCAGAGCCCCAGTATCTGGGCACACCCAAGTATTTCATCTTATGAGAGCTGCTCCATTTCTGAATCTGGTCAGGTTTTGCAGCACGCATATAGAATTTAAGTTCAGAGAAAAGTGGTCCATTTTCACTTGGTTCTACTTTAATGACATATGGAGCATCTGGTCCTATAATTCTAGAAGAATTTTCATCCGCAAGATAAAGACGACCAAATCCACCCTGTCCAATTGGTAACCCCAATTTCCATTGTTTTTTTGCTGAATCTGTTAGCACCTCTCCTGCAGGAAACTCTTCAGCCAGCTTTCTTTTAACTGGGGCCTTTCTGGCTCCTGTGGCTTTCTTGGGTGGCATGG
Full Trace Sequence: GACGGGAACAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCGTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAACCCAACTGTAAAACCGTTTTACGTGCCAAGATTTTTCCTTTGTTTTCAAAAATCTGTAACTGTTTCCATTTTTGGAATGCAGACCAGAGCCCCAGTATCTGGGCACACCCAAGTATTTCATCTTATGAGAGCTGCTCCATTTCTGAATCTGGTCAGGTTTTGCAGCACGCATATAGAATTTAAGTTCAGAGAAAAGTGGTCCATTTTCACTTGGTTCTACTTTAATGACATATGGAGCATCTGGTCCTATAATTCTAGAAGAATTTTCATCCGCAAGATAAAGACGACCAAATCCACCCTGTCCAATTGGTAACCCCAATTTCCATTGTTTTTTTGCTGAATCTGTTAGCACCTCTCCTGCAGGAAACTCTTCAGCCAGCTTTCTTTTAACTGGGGCCTTTCTGGCTCCTGTGGCTTTCTTGGGTGGCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAACATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAATCAAAATAAAATCATTATTTGGGGTCCAAAAAAAAAAAACTGACGTCGTTTTACAACACAATTGACATGGGTTTTTCGCTAAAAATTCTTACCCTTGTCCCAAAATAATGGGAGTTTGTCATATAACCAAAAAAAAAAAAAAAAGAGAAACTCACAAAAAAAAAACACCTTTCGGGGCCAAGAGANTNGGGNNGGGGAAAAAGACCCCTCCACCCCAAAGAACCCGCCCTTATGAGCAAAAAAAAANNNNGGGGGGTNTTATCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAACCCAACTGTAAAACCGTTTTAC