ORFeome > was ORF1 – XORFeome v1.0

was ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: was
Gene ID: 5760018
Gene Page ID: 5759990
ORF Xenbase ID: 17304507

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC129739
Original XGC clone length: 1425

Human orthology & disease relationships

NCBI Entrez ID: 7454
Ensembl gene IDs: ENSG00000015285,LRG_125
Directly associated (OMIM) disease MIM numbers: 300299,301000,313900
Indirectly associated (Lage, et al.) disease MIM numbers: 124900,125800,153640,153650,155100,161800,182290,301000,313900,600652,603278,603622,604416,605249,607841,608203,608751

Library Location

Plate ID: GDExl11092
Well Location: B09

Sequences - 5ʹ (forward) EST

Accession: JZ838946
dbEST ID: 79656648
Trimmed Sequence: ATGAGTCGAGGGGGGCCTAAAACTGGAGCCCGTCTGCAGGACAATGTCTCTTCCAGCCTCCTTTTGCCCCAGGAGAACCAGAAAGTATTCCAGCTGCTTGGACGGAAGTGCACGACGCTGGCAACCACAGTGGTTCAGCTGTTGGTGGCCCATGGCAGTGATCGGTGGGCAAAGCAATTTGTGGGGGTCCTGTGTTTGGTGAAGGACAATCCCAGGCGTTCCTACTTCTTCCAGCTGTTTGACCTGCGGGACGAGAAGATGGTGTGGGAGCAGGAGATATACGAGCAGCTAAAATACAACACTCCCCGTCTCTACTTTCATATCTTCTGCTCCGATGATTGCCAGACTGGGCTCAATTTTGCAGATGAGGGTGAAGCTGCAGCTTTTCAATTGGTTGTAGAAGAGAAACTAAAGAAGAAACAGCACAGACAAGACAGACGGCAAAATTTACCTCCTCCTCCTCCAGTATCAGATGATCGACGAACCTCTCTACCCCTGCCACCACCTCTTCCACCTCCAACTGTACGCTCTGGAGGTCCCCCACCCCCACCATCCCCACCCCCACCATCAACCCCAGTTCTGCCTGCAACAAGTGGCCCAGCACCTCCTCCACCCCCTCCCCTTGCAGGAAACCAAAGCACCCCACCCCCCTTCAAGAGAACTTGGCGCCCCTTTTGGAACCAAATTGTCCAGGGAATCCGGTGAAAAAAGGTCCAAATTCGGCAAACCATCCCCGTCTTCCCCCCCCCCCTCTTTACGGGTTAATGGAATGCTCTTGATCGTGTTCAATCCAAAAACACCCGGCGGGACCCCTCCGTTTCCTTAAAATTTCTTATAA
Full Trace Sequence: CGGGGGCCAAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAGTCGAGGGGGGCCTAAAACTGGAGCCCGTCTGCAGGACAATGTCTCTTCCAGCCTCCTTTTGCCCCAGGAGAACCAGAAAGTATTCCAGCTGCTTGGACGGAAGTGCACGACGCTGGCAACCACAGTGGTTCAGCTGTTGGTGGCCCATGGCAGTGATCGGTGGGCAAAGCAATTTGTGGGGGTCCTGTGTTTGGTGAAGGACAATCCCAGGCGTTCCTACTTCTTCCAGCTGTTTGACCTGCGGGACGAGAAGATGGTGTGGGAGCAGGAGATATACGAGCAGCTAAAATACAACACTCCCCGTCTCTACTTTCATATCTTCTGCTCCGATGATTGCCAGACTGGGCTCAATTTTGCAGATGAGGGTGAAGCTGCAGCTTTTCAATTGGTTGTAGAAGAGAAACTAAAGAAGAAACAGCACAGACAAGACAGACGGCAAAATTTACCTCCTCCTCCTCCAGTATCAGATGATCGACGAACCTCTCTACCCCTGCCACCACCTCTTCCACCTCCAACTGTACGCTCTGGAGGTCCCCCACCCCCACCATCCCCACCCCCACCATCAACCCCAGTTCTGCCTGCAACAAGTGGCCCAGCACCTCCTCCACCCCCTCCCCTTGCAGGAAACCAAAGCACCCCACCCCCCTTCAAGAGAACTTGGCGCCCCTTTTGGAACCAAATTGTCCAGGGAATCCGGTGAAAAAAGGTCCAAATTCGGCAAACCATCCCCGTCTTCCCCCCCCCCCTCTTTACGGGTTAATGGAATGCTCTTGATCGTGTTCAATCCAAAAACACCCGGCGGGACCCCTCCGTTTCCTTAAAATTTCTTATAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGTCGAGGGGGGCCTAA

Sequences - 3ʹ (reverse) EST

Accession: JZ838945
dbEST ID: 79656647
Trimmed Sequence: GTCCTCCCATTCATCATCGTCATCATCATCAGCTCCATCTTCCTCATCATCATCTGATGAATGAATGGCTTTGCTGCGTTTCTGCATGACATGTATCAGAGCATCCACTAACCCCTCAGAGCTGGGCTGAGGAGATGGAGGAGGTTCTGCAGAATCTGTGACCTTATTCAACTGGATCCCCTGACGAATCTGATCCAAAAGGGCGCCACGTCCTCCTGAAGGGGTTGGGGTGCTCTGGTTTCCTGACAGAGGAGGGGGTGGAGGAGGTGCTGGGCCACTTGTTGCAGGCAGAACTGGGGCTGATGGTGGGGGTGGGGGAGGTGGNGGGNGTCGNNGNGCCCGNGGGGGGGGGGGNGNGGGNNGNNGGGGNGGNNCGGGGGCCNCGCGGTCGGCGGGGTGCGCCCCCGCGCGGCGGGNGGGCGTGGGGTGGGGGTGTTTCCGTGCCCCGCGGGGCTTTCTCCTCCGGTGCGGGGGGTGGGGTGGGCGGCCCCGCCCCGCCGCCCCCCGCCGNNGGTGTGGGGTTNGGGGGGGGCCNGGCTGGGTTGGGNGGNGGGCCGGNCCCCNGTGGGGGGGGGGGGGGGNTTGGGGGGTTGNGGCCNGCGGGGCGGGCTCCCCTGTGGGTTCGCGGTTGTGGGGGGTNNCTGGGGGCGNGGGGGGGGGGGGGGGGGGGGGGGGGGGCGTGGCGCCCNCGCGGCGGGGCGCCGGGCCCNCGTTCGGGGGGGTGGGTCTTTGTTTGGNGGGGCGGGGGGGGGGGGGGN
Full Trace Sequence: AAAGCGGCTATGGACCATGGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTCCTCCCATTCATCATCGTCATCATCATCAGCTCCATCTTCCTCATCATCATCTGATGAATGAATGGCTTTGCTGCGTTTCTGCATGACATGTATCAGAGCATCCACTAACCCCTCAGAGCTGGGCTGAGGAGATGGAGGAGGTTCTGCAGAATCTGTGACCTTATTCAACTGGATCCCCTGACGAATCTGATCCAAAAGGGCGCCACGTCCTCCTGAAGGGGTTGGGGTGCTCTGGTTTCCTGACAGAGGAGGGGGTGGAGGAGGTGCTGGGCCACTTGTTGCAGGCAGAACTGGGGCTGATGGTGGGGGTGGGGGAGGTGGNGGGNGTCGNNGNGCCCGNGGGGGGGGGGGNGNGGGNNGNNGGGGNGGNNCGGGGGCCNCGCGGTCGGCGGGGTGCGCCCCCGCGCGGCGGGNGGGCGTGGGGTGGGGGTGTTTCCGTGCCCCGCGGGGCTTTCTCCTCCGGTGCGGGGGGTGGGGTGGGCGGCCCCGCCCCGCCGCCCCCCGCCGNNGGTGTGGGGTTNGGGGGGGGCCNGGCTGGGTTGGGNGGNGGGCCGGNCCCCNGTGGGGGGGGGGGGGGGNTTGGGGGGTTGNGGCCNGCGGGGCGGGCTCCCCTGTGGGTTCGCGGTTGTGGGGGGTNNCTGGGGGCGNGGGGGGGGGGGGGGGGGGGGGGGGGGGCGTGGCGCCCNCGCGGCGGGGCGCCGGGCCCNCGTTCGGGGGGGTGGGTCTTTGTTTGGNGGGGCGGGGGGGGGGGGGGN
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTCCTCCCATTCATCATC