ORFeome > wash1 ORF1 – XORFeome v1.0

wash1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: wash1
Gene ID: 5947866
Gene Page ID: 5947820
ORF Xenbase ID: 17304519

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC085201
Original XGC clone length: 1419

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11071
Well Location: E01

Sequences - 5ʹ (forward) EST

Accession: JZ835099
dbEST ID: 79652801
Trimmed Sequence: ATGCCACAGAATCGGTCAGTGGAGAGCCAGGCTTATTCCCTTCCCCTTATCCTGCCAGACCTGCGAAGGGAGGAGGCCATACATCAGATCACAGACACCTTGCAGCACCTGCAGACTGTATCCAATGACATCTTCAGCAGGATTCTGCAGAGGGTAGAGACCAACAGAGACCAACTGCAGAGAATCAATGGCCGACTGAGCCTTGCACAAGCAAAGATTGAAAGGCTCAAAGGCAGCAAGAAAGCCATTAAGGTTTTCTCCAGTGCTAAGTATCCTGCACCTGACCGCCTTCAGGAATACAGTTCCATTTTTGCCGGTGCCAAAGATGGCTGGTCGGCAAAAAAGCAGCGTCACAAAATTCAGAGTAAGCACCGGCCACTGGATGAACAGGCTGTTCAGGAAAAACTGAAGTATTTCCCAGTGTGCGTGAATACAAGAGGACAAGATGAGGAAAGCGCAGAAGAAGGGTTGGGCAGCCTCCCCAGAAACATCAATTCTGTCAGCTCCTTGCTCCTTTTCAACACAACAGAGAATCTCTATAAAAAGTATGTGTTGCTTGACCCGCTTGCTGGGGTTGTGACTAGGACTAACCCTGCGTTAGAGGGAGAGGATGAAGAGAAGCTTTTCGATGCACCCCTTTCCTCACTAAGAGGGAGCAGCTGGAGCGACCGACAGCAGAAAATTACTTCTTCGTGCCAGAACCTGGGGACAAGTCCCCCGAAATATAATGTTCCCTTACTTCTTCTGCCGGGAAACTTGGTGGGGAGGTGGCTGGAAGAATCCCCTGGGATCCGGCGCGCTGAA
Full Trace Sequence: GGGTCTTAGCTCGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCCACAGAATCGGTCAGTGGAGAGCCAGGCTTATTCCCTTCCCCTTATCCTGCCAGACCTGCGAAGGGAGGAGGCCATACATCAGATCACAGACACCTTGCAGCACCTGCAGACTGTATCCAATGACATCTTCAGCAGGATTCTGCAGAGGGTAGAGACCAACAGAGACCAACTGCAGAGAATCAATGGCCGACTGAGCCTTGCACAAGCAAAGATTGAAAGGCTCAAAGGCAGCAAGAAAGCCATTAAGGTTTTCTCCAGTGCTAAGTATCCTGCACCTGACCGCCTTCAGGAATACAGTTCCATTTTTGCCGGTGCCAAAGATGGCTGGTCGGCAAAAAAGCAGCGTCACAAAATTCAGAGTAAGCACCGGCCACTGGATGAACAGGCTGTTCAGGAAAAACTGAAGTATTTCCCAGTGTGCGTGAATACAAGAGGACAAGATGAGGAAAGCGCAGAAGAAGGGTTGGGCAGCCTCCCCAGAAACATCAATTCTGTCAGCTCCTTGCTCCTTTTCAACACAACAGAGAATCTCTATAAAAAGTATGTGTTGCTTGACCCGCTTGCTGGGGTTGTGACTAGGACTAACCCTGCGTTAGAGGGAGAGGATGAAGAGAAGCTTTTCGATGCACCCCTTTCCTCACTAAGAGGGAGCAGCTGGAGCGACCGACAGCAGAAAATTACTTCTTCGTGCCAGAACCTGGGGACAAGTCCCCCGAAATATAATGTTCCCTTACTTCTTCTGCCGGGAAACTTGGTGGGGAGGTGGCTGGAAGAATCCCCTGGGATCCGGCGCGCTGAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCCACAGAATCGGTCAG

Sequences - 3ʹ (reverse) EST

Accession: JZ835100
dbEST ID: 79652802
Trimmed Sequence: AGACTCCCAGTCATCCTCATCTCCATCTCCCGAGGCCTGATGCGGTGGAGGTAACGGTGGAATGGTGTCGGAAATGCGAGCAAAGGCACCTGTGGGACCGTCTCCACTTGCTTCTCCAGCGGCCGGCACCTTTCCGGATATGCCTTTGCGTCTCATTGCCAGCTTATTAAAGAGATCTGACATGAGGTCACCGCCACCTCCTGTTGCTCCAACTTGTTCCTGTTCCTTCATCTTCTTCTTCTCCAGCTTTTTCTCCTTCACGTTCCGCAGATTGGCTTTCCCAATGCCGCCTGCCTGACGGATGGACTCCAGCAAGGATGCCCGTCCATTAGAAGGATTGACCACTTCTTTGGGAGCCCCCTGGACGGCACCTTGGTCTCCAGGGTCACTGCCACCTTTCTTAGCAGGAGCAGGAATAGACAAAGGTGGTGGCAGCAGACGACCATCTTGCCTATCAGTTATAGAGTTTTCTGTTATATCCTCGGTGGTGAAGGTTGGAAGCTCAGGGATGGGAACTCCAGGTGCAGAAGGAGCAAAACCCGGCCCAAGGTCAGCGCTGGTACTGAGATCATCGCCCACCTCCAGCAGGTCCCGCAGAGAGTAAGGGACATCATTTTTCGGGACTTGTCCCAGGTCTGGGCAGGTAGAAGTAATTTTTTGGCGGTCCGGTCCCTCCGCCTGCTCCCCCTTGGTGGAGGGAAAAGGGGCGGGATCCGGAAAGCCTTTCTTTTTCCTTTCTCCTCCCCCTCTAACCCCCGGGGGTTAAGCC
Full Trace Sequence: GTGCCGGGAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAGACTCCCAGTCATCCTCATCTCCATCTCCCGAGGCCTGATGCGGTGGAGGTAACGGTGGAATGGTGTCGGAAATGCGAGCAAAGGCACCTGTGGGACCGTCTCCACTTGCTTCTCCAGCGGCCGGCACCTTTCCGGATATGCCTTTGCGTCTCATTGCCAGCTTATTAAAGAGATCTGACATGAGGTCACCGCCACCTCCTGTTGCTCCAACTTGTTCCTGTTCCTTCATCTTCTTCTTCTCCAGCTTTTTCTCCTTCACGTTCCGCAGATTGGCTTTCCCAATGCCGCCTGCCTGACGGATGGACTCCAGCAAGGATGCCCGTCCATTAGAAGGATTGACCACTTCTTTGGGAGCCCCCTGGACGGCACCTTGGTCTCCAGGGTCACTGCCACCTTTCTTAGCAGGAGCAGGAATAGACAAAGGTGGTGGCAGCAGACGACCATCTTGCCTATCAGTTATAGAGTTTTCTGTTATATCCTCGGTGGTGAAGGTTGGAAGCTCAGGGATGGGAACTCCAGGTGCAGAAGGAGCAAAACCCGGCCCAAGGTCAGCGCTGGTACTGAGATCATCGCCCACCTCCAGCAGGTCCCGCAGAGAGTAAGGGACATCATTTTTCGGGACTTGTCCCAGGTCTGGGCAGGTAGAAGTAATTTTTTGGCGGTCCGGTCCCTCCGCCTGCTCCCCCTTGGTGGAGGGAAAAGGGGCGGGATCCGGAAAGCCTTTCTTTTTCCTTTCTCCTCCCCCTCTAACCCCCGGGGGTTAAGCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAGACTCCCAGTCATCCTCA