ORFeome > wbp1 ORF1 – XORFeome v1.0

wbp1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: wbp1
Gene ID: 6251705
Gene Page ID: 5825240
ORF Xenbase ID: 17304525

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC097596
Original XGC clone length: 927

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11072
Well Location: H11

Sequences - 5ʹ (forward) EST

Accession: JZ835480
dbEST ID: 79653182
Trimmed Sequence: ATGGACAACAGCGGGGGATTATGGGAAAGGAAGGAGGACTCGGGGCGCCTGGCTCAGGAGCAGTGCCCTGGGGTGAACAGCCGACCCTATGTGTGTGAGACGGGTCACTGCTGTGGGGAGAACGGCTGCTGCACCTACTACTATGAGCTGTGGTGGTTCTGGTTTCTATGGAGCGTCCTGATCCTTCTGAGCTGCTGTTGTGCCTACCGACACCGCCGTGCAAAACTGCACCTGCAGCACCAGCAGAGACAGAGGGAGATCAACCTGATCACTTACCAACGTGCCTCTCACTACTCACCTTCTACACTGGATCTCAGAGTGTTGGCATCTTTTAAGCTCCCGGCTTATGAGGAAGTTGCGTGCCGTCCCACAACCCCTCCACCTCCTTACAGCTCCATCCTCAACCCATTTGGACCGCCTTCTTCCCCACCCCCATCACTGGAGGACACAGCCTCCCCTAGTACGGAGCCCTCCAGCTGTTGCTCTTGTAACTCAGACTGTGAGACTTCAGGCAGTAGCTCGTCCTTCTCTCTGCAGGTCACAGATGAGACGGGGGCGAGCCAGGGAAGCACGGCCAGTTGGGAGGAGAGTCCGGAGGAGGAGGAGCAGGGGGCCATTGGCAGGGGGGCTGCCTTCTCTTCCTATGTGGACTTGTTTGAGGGAGGCAGCCATATCTGCTGGGGCATTGAGGGAGAAGAGGAGGATGATGATGATGATGAATGAGGAGGGAAAAAAACCGTTTCATACGGCCGAAGGCTGACGGGGGGACTCCGGGGAATAAAGGGTGTTGCCCGCCTGTCAGAAATG
Full Trace Sequence: CGGTTCATAGCTCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGACAACAGCGGGGGATTATGGGAAAGGAAGGAGGACTCGGGGCGCCTGGCTCAGGAGCAGTGCCCTGGGGTGAACAGCCGACCCTATGTGTGTGAGACGGGTCACTGCTGTGGGGAGAACGGCTGCTGCACCTACTACTATGAGCTGTGGTGGTTCTGGTTTCTATGGAGCGTCCTGATCCTTCTGAGCTGCTGTTGTGCCTACCGACACCGCCGTGCAAAACTGCACCTGCAGCACCAGCAGAGACAGAGGGAGATCAACCTGATCACTTACCAACGTGCCTCTCACTACTCACCTTCTACACTGGATCTCAGAGTGTTGGCATCTTTTAAGCTCCCGGCTTATGAGGAAGTTGCGTGCCGTCCCACAACCCCTCCACCTCCTTACAGCTCCATCCTCAACCCATTTGGACCGCCTTCTTCCCCACCCCCATCACTGGAGGACACAGCCTCCCCTAGTACGGAGCCCTCCAGCTGTTGCTCTTGTAACTCAGACTGTGAGACTTCAGGCAGTAGCTCGTCCTTCTCTCTGCAGGTCACAGATGAGACGGGGGCGAGCCAGGGAAGCACGGCCAGTTGGGAGGAGAGTCCGGAGGAGGAGGAGCAGGGGGCCATTGGCAGGGGGGCTGCCTTCTCTTCCTATGTGGACTTGTTTGAGGGAGGCAGCCATATCTGCTGGGGCATTGAGGGAGAAGAGGAGGATGATGATGATGATGAATGAGGAGGGAAAAAAACCGTTTCATACGGCCGAAGGCTGACGGGGGGACTCCGGGGAATAAAGGGTGTTGCCCGCCTGTCAGAAATG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGACAACAGCGGGGGA

Sequences - 3ʹ (reverse) EST

Accession: JZ835481
dbEST ID: 79653183
Trimmed Sequence: TACGGGCTGCACAGGTGAGTCTGCCTCTACCTCGTCCTTCTCTAATGGAGACTCCCCACCCTCTGTTTTATTTCTCTCTGCGCACCCAGGACTGTCATGTGGGTCGCTCCTTTCCTCTTCCTCTCCCACTATCTGACAGCGGCACACCTCTATCCCAGAGTCCCCCGTCAGCCTCCGCCGTCTGTAACGCTCTTCTTCCTCCTCATCATCATCATCATCATCCTCCTCTTCCTCCTCAATGGCCCAGCAGATATGGCTGCCTCCCTCAAACAAGTCCACATAGGAAGAGAAGGCAGCCCCCCTGCCAATGGCCCCCTGCTCCTCCTCCTCCGGACTCTCCTCCCAACTGGCCGTGCTTCCCTGGCTCGCCCCCGTCTCATCTGTGACCTGCAGAGAGAAGGACGAGCTACTGCCTGAAGTCTCACAGTCTGAGTTACAAGAGCAACAGCTGGAGGGCTCCGTACTAGGGGAGGCTGTGTCCTCCATGATGGGGGTGGGGGAAAGAAGGCGGTCCAAATGGGTTGAGGATGGAGCTGTAAGAGGTGTGAGGGGGTTTGGGGGAACCGCACGCAAACTTCCTCATAAGCCCGGGAGCTTAAAAGATGCCCACACTCTAAGATCCCGTGTAGAAAGTGAGTTATGGAGAGGCACCGTTGGTAAGTGATCAAGGTTGAATCTCCCTCTGTCCCCGTCGGGTTGCGTGCAGGGGCGATTTTTTTCCACGGGGCGGTGTTTCGGGTGGGGGCCCACCCAGCCCGCCCTT
Full Trace Sequence: CGGGGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATACGGGCTGCACAGGTGAGTCTGCCTCTACCTCGTCCTTCTCTAATGGAGACTCCCCACCCTCTGTTTTATTTCTCTCTGCGCACCCAGGACTGTCATGTGGGTCGCTCCTTTCCTCTTCCTCTCCCACTATCTGACAGCGGCACACCTCTATCCCAGAGTCCCCCGTCAGCCTCCGCCGTCTGTAACGCTCTTCTTCCTCCTCATCATCATCATCATCATCCTCCTCTTCCTCCTCAATGGCCCAGCAGATATGGCTGCCTCCCTCAAACAAGTCCACATAGGAAGAGAAGGCAGCCCCCCTGCCAATGGCCCCCTGCTCCTCCTCCTCCGGACTCTCCTCCCAACTGGCCGTGCTTCCCTGGCTCGCCCCCGTCTCATCTGTGACCTGCAGAGAGAAGGACGAGCTACTGCCTGAAGTCTCACAGTCTGAGTTACAAGAGCAACAGCTGGAGGGCTCCGTACTAGGGGAGGCTGTGTCCTCCATGATGGGGGTGGGGGAAAGAAGGCGGTCCAAATGGGTTGAGGATGGAGCTGTAAGAGGTGTGAGGGGGTTTGGGGGAACCGCACGCAAACTTCCTCATAAGCCCGGGAGCTTAAAAGATGCCCACACTCTAAGATCCCGTGTAGAAAGTGAGTTATGGAGAGGCACCGTTGGTAAGTGATCAAGGTTGAATCTCCCTCTGTCCCCGTCGGGTTGCGTGCAGGGGCGATTTTTTTCCACGGGGCGGTGTTTCGGGTGGGGGCCCACCCAGCCCGCCCTT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATACGGGCTGCACAGGTGA