ORFeome > wbp2 ORF2 – XORFeome v1.0

wbp2 ORF2 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol:
Gene ID: 6256430
Gene Page ID:
ORF Xenbase ID: 17304537

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC124980
Original XGC clone length: 876

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11084
Well Location: C01

Sequences - 5ʹ (forward) EST

Accession: JZ837374
dbEST ID: 79655076
Trimmed Sequence: ATGTCACTTAATAAGAACCACTCACAGGGGGCCGGGATCATTGTCAGCAACGGGGAGAGTATTCTCAGACAGTGTAAAGATGTGGAACTCTCCTTCAGCGATATGTCTCACAAATCAGAAGCATTCAGAGGCACAAAGAAAGGATCGCTATATCTCACCGCCTACAGGGTGATCTTTCTAAGCAAAGGGAAAGACCCCATGATGTCCTTCAATATGCCATTCTACCTGATGAAAGGATGCTCCATAGAACAGCCAGTCTTCTCTGCCAACTACATCAAGGGAACCATCAGTGCTGAACCTGGAGATGGCTGGGAGGGTAAAACCTCTTTTAAACTTACATTTAACAGTGGAGGAGCTATTGAATTTGGACAAATCATGTTCAAAATGGCAACTTCTGCTTCCAGAGCCCCTCCTGTTCCTCATGCTGCATATGGATACACTCCTGCTGCAGGAGGATATGGACCAGGCGGGTACCCTCCAGCTCCAGGAATATATACACCCCCACCCCAACCATCAGGCCCTTATCCATATGGACCCCCTGCTATGAATGGATATGGACCACCTCCGAATGCTATGGGATACCCGTATGCTCCGCCACCGGGACCTGGCATGTATCCACCCCCTTCTGAAATGAATCCCATTTACTTGGCTCCCCCGCCACCTTATCCCGGAACCCCGGATAAGGGACCCCCCGTATATGGAACCCCCCGCCCCTTCCCCTCCCCCTGGACCCTGGAAATCGGGGAATGCCGGGGAGGCGGGGGAGGCGGGCGAAACCCCAGCCCGGGGGGATATTATGAAACCCCCCCTCTACCCCCCAAAAAGT
Full Trace Sequence: CGGGGCCCAAATAANTGATTTTATTTNTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCACTTAATAAGAACCACTCACAGGGGGCCGGGATCATTGTCAGCAACGGGGAGAGTATTCTCAGACAGTGTAAAGATGTGGAACTCTCCTTCAGCGATATGTCTCACAAATCAGAAGCATTCAGAGGCACAAAGAAAGGATCGCTATATCTCACCGCCTACAGGGTGATCTTTCTAAGCAAAGGGAAAGACCCCATGATGTCCTTCAATATGCCATTCTACCTGATGAAAGGATGCTCCATAGAACAGCCAGTCTTCTCTGCCAACTACATCAAGGGAACCATCAGTGCTGAACCTGGAGATGGCTGGGAGGGTAAAACCTCTTTTAAACTTACATTTAACAGTGGAGGAGCTATTGAATTTGGACAAATCATGTTCAAAATGGCAACTTCTGCTTCCAGAGCCCCTCCTGTTCCTCATGCTGCATATGGATACACTCCTGCTGCAGGAGGATATGGACCAGGCGGGTACCCTCCAGCTCCAGGAATATATACACCCCCACCCCAACCATCAGGCCCTTATCCATATGGACCCCCTGCTATGAATGGATATGGACCACCTCCGAATGCTATGGGATACCCGTATGCTCCGCCACCGGGACCTGGCATGTATCCACCCCCTTCTGAAATGAATCCCATTTACTTGGCTCCCCCGCCACCTTATCCCGGAACCCCGGATAAGGGACCCCCCGTATATGGAACCCCCCGCCCCTTCCCCTCCCCCTGGACCCTGGAAATCGGGGAATGCCGGGGAGGCGGGGGAGGCGGGCGAAACCCCAGCCCGGGGGGATATTATGAAACCCCCCCTCTACCCCCCAAAAAGT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCACTTAATAAGAACCACTCA

Sequences - 3ʹ (reverse) EST

Accession: JZ837373
dbEST ID: 79655075
Trimmed Sequence: ATTGTTCTTCTTATCCTCATAGGGAGCATATGGAGGTGGACGATCCATAGGCATGTACACATTGTGCGGGTCAGCTGGGTTATAATATGCACTGGATGCTGCTTCTGTGGCTTTGCTGCCTCCAGGCATACCAGTATCCATGGATCCAGAGGGAGCTGAAGGTGCTGGGGTTCCATTATATGGGGGTCCATTATACGGGGGTCCAGGATAAGGTGGTGGAGGAGCCATGTAAATGGGATTCATTTCANGAGGGGGTGGATACATGCCAGGTCCTGGTGGCGGAGCATACGGGTATCCCATAGCATTCGGAGGTGGTCCATATCCATTCATAGCACGGGGTGCGTATGGATAGGGGCCTGATGGTTGGGGTGGGGGTGGGGGCATAAGGCATCTCGCGGGGGGAGGAGGGAGGGGGACGTGTGGGCCACCCCACACTTGGGGATCCTACACGCGCAACAAAACAAGAGGGGGGCCGAACCCGGCACGCGCGGGGGTTGGAGGGGGAGGGGAGCGACATAGGGGGGGGGGAGCTACGTCGCGGCGAGGGGAGGGGGGGGGGGCCGCCGCCCCCGCCTGGGAGGAAGGGCGGGTGGGGTGTGGGCGGGTTCCAACGGCAAGGGAGAGGCTGGGGGTGGGGGGGGGGGAGGCGCGGGGGGGGGCGGGACAAACGCAGCAACGGGGGGGGAAAGAGAGGAGGGGGGGTGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGCGGGGGGGAGAGGGGGGGGGGGG
Full Trace Sequence: GGGGAAAAGGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGNCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAATTGTTCTTCTTATCCTCATAGGGAGCATATGGAGGTGGACGATCCATAGGCATGTACACATTGTGCGGGTCAGCTGGGTTATAATATGCACTGGATGCTGCTTCTGTGGCTTTGCTGCCTCCAGGCATACCAGTATCCATGGATCCAGAGGGAGCTGAAGGTGCTGGGGTTCCATTATATGGGGGTCCATTATACGGGGGTCCAGGATAAGGTGGTGGAGGAGCCATGTAAATGGGATTCATTTCANGAGGGGGTGGATACATGCCAGGTCCTGGTGGCGGAGCATACGGGTATCCCATAGCATTCGGAGGTGGTCCATATCCATTCATAGCACGGGGTGCGTATGGATAGGGGCCTGATGGTTGGGGTGGGGGTGGGGGCATAAGGCATCTCGCGGGGGGAGGAGGGAGGGGGACGTGTGGGCCACCCCACACTTGGGGATCCTACACGCGCAACAAAACAAGAGGGGGGCCGAACCCGGCACGCGCGGGGGTTGGAGGGGGAGGGGAGCGACATAGGGGGGGGGGAGCTACGTCGCGGCGAGGGGAGGGGGGGGGGGCCGCCGCCCCCGCCTGGGAGGAAGGGCGGGTGGGGTGTGGGCGGGTTCCAACGGCAAGGGAGAGGCTGGGGGTGGGGGGGGGGGAGGCGCGGGGGGGGGCGGGACAAACGCAGCAACGGGGGGGGAAAGAGAGGAGGGGGGGTGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGCGGGGGGGAGAGGGGGGGGGGGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAATTGTTCTTCTTATCCTCATAGGG